DARS1 (NM_001293312) Human Untagged Clone

CAT#: SC335884

DARS (untagged) - Human aspartyl-tRNA synthetase (DARS), transcript variant 2


  "NM_001293312" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
DARS Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DARS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DARS1
Synonyms aspRS; DARS; HBSL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335884 representing NM_001293312.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTTAAATTTGCTGCCAACATCAACAAAGAGAGCATTGTGGATGTAGAAGGTGTTGTGAGAAAAGTG
AATCAGAAAATTGGAAGCTGTACACAGCAAGACGTTGAGTTACATGTTCAGAAGATTTATGTGATCAGT
TTGGCTGAACCCCGTCTGCCCCTGCAGCTGGATGATGCTGTTCGGCCTGAGGCAGAAGGAGAAGAGGAA
GGAAGAGCTACTGTTAACCAGGATACAAGATTAGACAACAGAGTCATTGATCTTAGGACATCAACTAGT
CAGGCAGTCTTCCGTCTCCAGTCTGGCATCTGCCATCTCTTCCGAGAAACTTTAATTAACAAAGGTTTT
GTGGAAATCCAAACTCCTAAAATTATTTCAGCTGCCAGTGAAGGAGGAGCCAATGTTTTTACTGTGTCA
TATTTTAAAAATAATGCATACCTGGCTCAGTCCCCACAGCTATATAAGCAAATGTGCATTTGTGCTGAT
TTTGAGAAGGTTTTCTCTATTGGACCAGTATTCAGAGCGGAAGACTCTAATACCCATAGACATCTAACT
GAGTTTGTTGGTTTGGACATTGAAATGGCTTTTAATTACCATTACCACGAAGTTATGGAAGAAATTGCT
GACACCATGGTACAAATATTCAAAGGACTTCAAGAAAGGTTTCAGACTGAAATTCAAACAGTGAATAAA
CAGTTCCCATGTGAGCCATTCAAATTTTTGGAGCCAACTCTAAGACTAGAATATTGTGAAGCATTGGCT
ATGCTTAGGGAAGCTGGAGTCGAAATGGGAGATGAAGACGATCTGAGCACACCAAATGAAAAGCTGTTG
GGTCATTTGGTAAAGGAAAAGTATGATACAGATTTTTATATTCTTGATAAATATCCATTGGCTGTAAGA
CCTTTCTATACCATGCCTGACCCAAGAAATCCCAAACAGTCCAACTCTTACGATATGTTCATGAGAGGA
GAAGAAATATTGTCAGGAGCTCAAAGAATACATGATCCTCAACTGCTAACAGAGAGAGCTTTACATCAT
GGAATTGATTTGGAGAAAATTAAGGCTTACATTGATTCCTTCCGCTTTGGAGCCCCTCCTCATGCTGGT
GGAGGCATTGGATTGGAACGAGTTACTATGCTGTTTCTGGGATTGCATAATGTTCGTCAGACCTCCATG
TTCCCTCGTGATCCCAAACGACTCACTCCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001293312
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293312.1
RefSeq Size 3113 bp
RefSeq ORF 1206 bp
Locus ID 1615
UniProt ID P14868
Cytogenetics 2q21.3
Protein Pathways Aminoacyl-tRNA biosynthesis
MW 45.8 kDa
Gene Summary This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) lacks an exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.