SLC39A7 (NM_001288777) Human Untagged Clone

CAT#: SC335490

SLC39A7 (untagged) - Human solute carrier family 39 (zinc transporter), member 7 (SLC39A7), transcript variant 3


  "NM_001288777" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SLC39A7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC39A7
Synonyms D6S115E; D6S2244E; H2-KE4; HKE4; KE4; RING5; ZIP7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335490 representing NM_001288777.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGACCTGCACGACGATCTGCAAGAGGACTTCCATGGCCACAGCCACAGTGCTGATCTCAGCAGCT
CCATTTTTTGTCCTCTTCCTTATCCCCGTGGAGTCGAACTCTCCCCGGCATCGCTCTCTACTTCAGATC
TTGCTCAGTTTTGCTTCCGGTGGGCTCCTGGGAGATGCTTTCCTGCACCTCATTCCTCATGCTCTTGAA
CCTCATTCTCACCACACTCTGGAGCAACCCGGACATGGACACTCCCACAGTGGCCAGGGCCCCATTCTG
TCTGTGGGACTGTGGGTTCTCAGTGGAATTGTTGCCTTTCTTGTCGTGGAGAAATTTGTGAGACATGTG
AAAGGAGGACATGGTCACAGTCATGGACATGGACACGCTCACAGTCATACACGTGGAAGTCATGGACAT
GGAAGACAAGAGCGTTCTACCAAGGAGAAGCAGAGCTCAGAGGAAGAAGAAAAGGAAACAAGAGGGGTT
CAGAAGAGGCGAGGAGGGAGCACAGTACCCAAAGATGGGCCAGTGAGACCTCAGAACGCTGAAGAAGAA
AAAAGAGGCTTAGACCTGCGTGTGTCGGGGTACCTGAATCTGGCTGCTGACTTGGCACACAACTTCACT
GATGGTCTGGCCATTGGGGCTTCCTTTCGAGGGGGCCGGGGACTAGGGATCCTGACCACAATGACTGTC
CTGCTACATGAAGTGCCCCACGAGGTCGGAGACTTTGCCATCTTGGTCCAGTCTGGCTGCAGCAAAAAG
CAGGCGATGCGTCTGCAACTACTGACAGCAGTAGGGGCACTGGCAGGCACAGCCTGTGCCCTTCTCACT
GAAGGAGGAGCAGTGGGCAGTGAAATTGCAGGTGGTGCAGGTCCTGGCTGGGTCCTGCCATTTACTGCA
GGTGGCTTTATCTACGTAGCAACAGTGTCTGTGTTGCCCGAGCTGCTGAGGGAGGCATCACCATTGCAA
TCACTTCTGGAGGTGCTGGGGCTGCTGGGGGGAGTTATCATGATGGTGCTGATTGCCCACCTTGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288777
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288777.1
RefSeq Size 1888 bp
RefSeq ORF 1035 bp
Locus ID 7922
UniProt ID Q92504
Cytogenetics 6p21.32
Protein Families Transmembrane
MW 36.3 kDa
Gene Summary The protein encoded by this gene transports zinc from the Golgi and endoplasmic reticulum to the cytoplasm. This transport may be important for activation of tyrosine kinases, some of which could be involved in cancer progression. Therefore, modulation of the encoded protein could be useful as a therapeutic agent against cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which contains a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.