HOXC5 (NM_018953) Human Untagged Clone

CAT#: SC312516

HOXC5 (untagged)-Human homeobox C5 (HOXC5), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOXC5
• Synonyms: CP11; HOX3; HOX3D
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC312516 representing NM_018953.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCTCCTACGTAGCCAATTCATTCTATAAGCAGAGCCCCAATATCCCTGCCTATAACATGCAAACT
  TGTGGGAACTATGGATCGGCCTCAGAGGTGCAGGCATCCAGGTACTGCTACGGCGGATTGGACTTAAGC
  ATCACTTTCCCACCGCCTGCGCCTTCCAACTCTCTCCACGGGGTAGACATGGCTGCCAACCCCCGGGCT
  CACCCCGACCGCCCCGCCTGCAGCGCCGCGGCCGCTCCGGGACACGCTCCGGGCAGAGACGAAGCGGCT
  CCTCTGAACCCCGGGATGTACAGTCAGAAGGCGGCTCGCCCGGCGCTGGAGGAGCGAGCTAAGAGCAGT
  GGGGAGATCAAAGAGGAGCAGGCGCAGACAGGGCAGCCCGCCGGACTGAGCCAGCCACCGGCCCCGCCA
  CAGATTTACCCGTGGATGACCAAACTGCACATGAGCCACGAGACGGACGGCAAGCGGTCCCGAACCAGT
  TACACGCGCTACCAGACTCTGGAACTCGAGAAAGAATTCCACTTTAACCGCTACCTCACTCGCCGCAGG
  CGCATAGAGATCGCCAACAACTTGTGTCTCAATGAGAGACAGATCAAGATCTGGTTCCAGAACCGCAGG
  ATGAAGTGGAAGAAAGATTCCAAAATGAAAAGCAAAGAGGCTCTTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_018953
• Insert Size: 669 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_018953.3
• RefSeq Size: 1645 bp
• RefSeq ORF: 669 bp
• Locus ID: 3222
• UniProt ID: Q00444
• Cytogenetics: 12q13.13
• Domains: homeobox
• Protein Families: Transcription Factors
• MW: 25 kDa
• Gene Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the shorter transcript and is protein coding.