LYNX1 (NM_177457) Human Untagged Clone

CAT#: SC307097

LYNX1 (untagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 3


  "NM_177457" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LYNX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYNX1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_177457, the custom clone sequence may differ by one or more nucleotides
ATGACGCCCCTGCTCACCCTGATCCTGGTGGTCCTCATGGGCTTACCTCTGGCCCAGGCC
TTGGACTGCCACGTGTGTGCCTACAACGGAGACAACTGCTTCAACCCCATGCGCTGCCCG
GCTATGGTTGCCTACTGCATGACCACGCGCACCTACTACACCCCCACCAGGATGAAGGTC
AGTAAGTCCTGCGTGCCCCGCTGCTTCGAGACTGTGTATGATGGCTACTCCAAGCACGCG
TCCACCACCTCCTGCTGCCAGTACGACCTCTGCAACGGCACCGGCCTTGCCACCCCGGCC
ACCCTGGCCCTGGCCCCCATCCTCCTGGCCACCCTCTGGGGTCTCCTCTAA
Restriction Sites Please inquire     
ACCN NM_177457
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177457.2, NP_803252.1
RefSeq Size 1021 bp
RefSeq ORF 351 bp
Locus ID 66004
UniProt ID P0DP58
Cytogenetics 8q24.3
Protein Families Druggable Genome
Gene Summary This gene encodes a GPI-anchored, cell membrane bound member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This protein interacts with nicotinic acetylcholine receptors (nAChRs), and is thought to function as a modulator of nAChR activity to prevent excessive excitation. Alternatively spliced transcript variants have been found for this gene. Read-through transcription between this gene and the neighboring downstream gene (SLURP2) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017]
Transcript Variant: This variant (3) differs in the 3' UTR and in the coding region, compared to variant 1. The resulting isoform (c) is shorter, and has a distinct C-terminus when compared to isoform a. Isoform c is encoded by transcript variants 3, 4 and 5.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.