TOR1AIP2 (NM_022347) Human Untagged Clone
CAT#: SC305015
TOR1AIP2 (untagged)-Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1
"NM_022347" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TOR1AIP2 |
Synonyms | IFRG15; LULL1; NET9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305015 representing NM_022347.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTTCAGATAATTCACATTGCCCTGATTGTGGACAACAGTGGTTCCCTAGTTTAGAACTAGGCCAC TGGTTGTACCAAACTGAACTTGTTGAAAATGAATGTTACCAGGTATTCTTAGACCGTATTAACAGAGCT GATTATTGTCCTGAGTGTTATCCTGATAATCCTGCTAATAGAAGCCTTGTTCTTCCTTGGTCTTTCCCA CTTGAGTGGGCTCCCCAGAATCTCACCAGATGGACCTTTGAGAAAGCTTGCCATCCATTTCTTCTGGGT CCTCCACTGGTTAGAAAAAGAATACATGACTCTCGAGTAGCTGGTTTTAACCCTGCATTACAGTTAATC TTGACCAGAACAGATAAAACCTTAAACAAAAAACTGGGCCAAAACAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022347 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022347.3 |
RefSeq Size | 7074 bp |
RefSeq ORF | 396 bp |
Locus ID | 163590 |
UniProt ID | Q9H496 |
Cytogenetics | 1q25.2 |
Protein Families | Transmembrane |
MW | 15.3 kDa |
Gene Summary | One of the two protein isoforms encoded by this gene is a type II integral membrane protein found in the endoplasmic reticulum (ER). The encoded protein is a cofactor for the ATPase TorsinA, regulating the amount of TorsinA present in the ER compared to that found in the nuclear envelope. Defects in this protein are a cause of early onset primary dystonia, a neuromuscular disease. The other isoform encoded by this gene is an interferon alpha responsive protein whose cellular role has yet to be determined. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (1) represents the shorter transcript and encodes isoform a, interferon alpha responsive protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218684 | TOR1AIP2 (Myc-DDK-tagged)-Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1 |
USD 150.00 |
|
RC218684L3 | Lenti ORF clone of Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1, Myc-DDK-tagged |
USD 450.00 |
|
RC218684L4 | Lenti ORF clone of Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1, mGFP tagged |
USD 450.00 |
|
RG218684 | TOR1AIP2 (tGFP-tagged) - Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review