CDYL (NM_001143970) Human Untagged Clone

CAT#: SC325064

CDYL (untagged)-Human chromodomain protein, Y-like (CDYL), transcript variant 4


  "NM_001143970" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-CDYL Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CDYL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDYL
Synonyms CDYL1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001143970, the custom clone sequence may differ by one or more nucleotides
ATGGACCTAGCGAAGTCAGGTATCAAGATCCTCGTGCCTAAAAGCCCCGTTAAGAGCAGG
ACCGCAGTGGACGGCTTTCAGAGCGAGAGCCCTGAGAAACTGGACCCCGTCGAGCAGGGT
CAGGAGGACACAGTGGCACCCGAAGTGGCAGCGGAAAAGCCGGTCGGAGCTTTATTGGGC
CCCGGTGCCGAGAGGGCCAGGATGGGGAGCAGGCCCAGGATACACCCACTAGTGCCTCAG
GTGCCCGGCCCTGTGACTGCAGCCATGGCCACAGGCTTAGCTGTTAACGGGAAAGGTACA
TCTCCGTTCATGGATGCATTAACAGCCAATGGGACAACCAACATACAGACATCTGTTACA
GGAGTGACTGCCAGCAAAAGGAAATTTATTGACGACAGAAGAGACCAGCCTTTTGACAAG
CGATTGCGTTTCAGCGTGAGGCAAACAGAAAGTGCCTACAGATACAGAGATATTGTGGTC
AGGAAGCAGGATGGCTTCACCCACATCTTGTTATCCACAAAGTCCTCAGAGAATAACTCA
CTAAATCCAGAGGTAATGAGAGAAGTCCAGAGTGCTCTGAGCACGGCCGCTGCCGATGAC
AGCAAGCTGGTACTGCTCAGCGCCGTTGGCAGCGTCTTCTGTTGTGGACTTGACTTTATT
TATTTTATACGACGTCTGACAGATGACAGGAAAAGAGAAAGCACTAAAATGGCAGAAGCT
ATCAGAAACTTCGTGAATACTTTCATTCAATTTAAGAAGCCCATTATTGTAGCAGTCAAT
GGCCCAGCCATTGGTCTAGGAGCATCTATATTGCCTCTTTGCGATGTGGTTTGGGCTAAT
GAAAAGGCTTGGTTTCAAACACCCTATACCACCTTCGGACAGAGTCCAGATGGCTGTTCT
ACCGTTATGTTTCCCAAGATAATGGGAGGAGCATCTGCAAACGAGATGCTGCTCAGTGGA
CGGAAGCTGACAGCGCAGGAGGCGTGTGGCAAGGGCCTGGTCTCCCAGGTGTTTTGGCCC
GGGACGTTCACTCAGGAAGTGATGGTTCGCATTAAGGAGCTTGCCTCGTGCAATCCAGTT
GTGCTTGAGGAATCCAAAGCCCTCGTGCGCTGCAACATGAAGATGGAGCTGGAGCAGGCC
AACGAGAGGGAGTGTGAGGTGCTGAAGAAAATCTGGGGCTCGGCCCAGGGGATGGACTCC
ATGTTAAAGTACTTGCAGAGGAAGATCGATGAGTTC
Restriction Sites Please inquire     
ACCN NM_001143970
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143970.1, NP_001137442.1
RefSeq Size 3326 bp
RefSeq ORF 1239 bp
Locus ID 9425
UniProt ID Q9Y232
Cytogenetics 6p25.1
Gene Summary Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (d) has a shorter N-terminus compared to isoform a. Variants 4 and 5 both encode isoform d.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.