GLUD1 (NM_005271) Human Untagged Clone
CAT#: SC324246
GLUD1 (untagged)-Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein
"NM_005271" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GLUD1 |
Synonyms | GDH; GDH1; GLUD |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005271, the custom clone sequence may differ by one or more nucleotides
ATGTACCGCTACCTGGGCGAAGCGCTGTTGCTGTCCCGGGCCGGGCCCGCTGCCCTGGGCTCGGCGTCCG CCGACTCGGCCGCGTTGCTGGGCTGGGCCCGGGGACAGCCCGCCGCCGCCCCGCAGCCGGGGCTGGCATT GGCCGCCCGGCGCCACTACAGCGAGGCGGTGGCCGACCGCGAGGACGACCCCAACTTCTTCAAGATGGTG GAGGGCTTCTTCGATCGCGGCGCCAGCATCGTGGAGGACAAGCTGGTGGAGGACCTGAGGACCCGGGAGA GCGAGGAGCAGAAGCGGAACCGGGTGCGCGGCATCCTGCGGATCATCAAGCCCTGCAACCATGTGCTGAG TCTCTCCTTCCCCATCCGGCGCGACGACGGCTCCTGGGAGGTCATCGAAGGCTACCGGGCCCAGCACAGC CAGCACCGCACGCCCTGCAAGGGAGGTATCCGTTACAGCACTGATGTGAGTGTAGATGAAGTAAAAGCTT TGGCTTCTCTGATGACATACAAGTGTGCAGTGGTTGATGTGCCGTTTGGGGGTGCTAAAGCTGGTGTTAA GATCAATCCCAAGAACTATACTGATAATGAATTGGAAAAGATCACAAGGAGGTTCACCATGGAGCTAGCA AAAAAGGGCTTTATTGGTCCTGGCATTGATGTGCCTGCTCCAGACATGAGCACAGGTGAGCGGGAGATGT CCTGGATCGCTGATACCTATGCCAGCACCATAGGGCACTATGATATTAATGCACACGCCTGTGTTACTGG TAAACCCATCAGCCAAGGGGGAATCCATGGACGCATCTCTGCTACTGGCCGTGGTGTCTTCCATGGGATT GAAAATTTCATCAATGAAGCTTCTTACATGAGCATTTTAGGAATGACACCAGGGTTTGGAGATAAAACAT TTGTTGTTCAGGGATTTGGTAATGTGGGCCTACACTCTATGAGATATTTACATCGTTTTGGTGCTAAATG TATTGCTGTTGGTGAGTCTGATGGGAGTATATGGAATCCAGATGGTATTGACCCAAAGGAACTGGAAGAC TTCAAATTGCAACATGGGTCCATTCTGGGCTTCCCCAAGGCAAAGCCCTATGAAGGAAGCATCTTGGAGG CCGACTGTGACATACTGATCCCAGCTGCCAGTGAGAAGCAGTTGACCAAATCCAACGCACCCAGAGTCAA AGCCAAGATCATTGCTGAAGGTGCCAATGGGCCAACAACTCCAGAAGCTGACAAGATCTTCCTGGAGAGA AACATTATGGTTATTCCAGATCTCTACTTGAATGCTGGAGGAGTGACAGTATCTTACTTTGAGTGGCTGA AGAATCTAAATCATGTCAGCTATGGCCGTTTGACCTTCAAATATGAAAGGGATTCTAACTACCACTTGCT CATGTCTGTTCAAGAGAGTTTAGAAAGAAAATTTGGAAAGCATGGTGGAACTATTCCCATTGTACCCACG GCAGAGTTCCAAGACAGGATATCGGGTGCATCTGAGAAAGACATCGTGCACTCTGGCTTGGCATACACAA TGGAGCGTTCTGCCAGGCAAATTATGCGCACAGCCATGAAGTATAACCTGGGATTGGACCTGAGAACAGC TGCCTATGTTAATGCCATTGAGAAAGTCTTCAAAGTGTACAATGAAGCTGGTGTGACCTTCACATAG |
Restriction Sites | ECoRI-NOT |
ACCN | NM_005271 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005271.1, NP_005262.1 |
RefSeq Size | 3051 bp |
RefSeq ORF | 1677 bp |
Locus ID | 2746 |
UniProt ID | P00367 |
Cytogenetics | 10q23.2 |
Domains | GLFV_dehydrog, GLFV_dehydrog_N |
Protein Families | Druggable Genome |
Protein Pathways | Alanine, aspartate and glutamate metabolism, Arginine and proline metabolism, D-Glutamine and D-glutamate metabolism, Metabolic pathways, Nitrogen metabolism |
Gene Summary | This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211132 | GLUD1 (Myc-DDK-tagged)-Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein |
USD 779.00 |
|
RC211132L1 | Lenti ORF clone of Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 1,079.00 |
|
RC211132L2 | Lenti ORF clone of Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 1,079.00 |
|
RC211132L3 | Lenti ORF clone of Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 1,079.00 |
|
RC211132L4 | Lenti ORF clone of Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 1,079.00 |
|
RG211132 | GLUD1 (tGFP-tagged) - Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein |
USD 979.00 |
|
SC116830 | GLUD1 (untagged)-Human glutamate dehydrogenase 1 (GLUD1), nuclear gene encoding mitochondrial protein |
USD 780.00 |
{0} Product Review(s)
Be the first one to submit a review