Ahcyl1 (NM_001108561) Rat Untagged Clone

CAT#: RN206216

Ahcyl1 (untagged ORF) - Rat S-adenosylhomocysteine hydrolase-like 1 (Ahcyl1), (10 ug)


  "NM_001108561" in other vectors (3)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ahcyl1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ahcyl1
Synonyms IRBIT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN206216 representing NM_001108561
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGAGTTCACCAAATTCCCTACTAAGACTGGCCGGAGATCCTTGTCTCGCTCCATCTCACAGTCCT
CCACAGACAGCTACAGTTCAGCTGCATCCTATACAGATAGCTCTGATGATGAGGTTTCCCCCCGAGAGAA
GCAGCAAACCAACTCAAAGGGCAGCAGCAATTTCTGTGTGAAGAACATCAAGCAGGCAGAGTTTGGACGC
CGGGAGATTGAGATTGCAGAGCAAGACATGTCTGCTCTGATTTCACTCAGGAAACGTGCTCAGGGAGAGA
AGCCTTTGGCTGGTGCTAAAATAGTGGGCTGTACACACATCACAGCCCAGACAGCGGTATTGATTGAGAC
ACTTTGTGCCCTGGGGGCTCAGTGCCGCTGGTCTGCCTGCAACATCTATTCAACTCAGAATGAGGTAGCT
GCAGCACTGGCTGAGGCTGGAGTTGCAGTGTTTGCTTGGAAGGGCGAGTCAGAAGATGATTTCTGGTGGT
GCATTGACCGCTGTGTCAACATGGATGGGTGGCAGGCTAACATGATCCTGGATGATGGGGGAGACTTAAC
CCACTGGGTTTATAAGAAGTATCCAAACGTGTTTAAGAAGATCCGAGGCATTGTGGAAGAGAGCGTGACT
GGTGTTCACAGGCTGTATCAGCTCTCCAAAGCTGGGAAGCTCTGTGTTCCAGCCATGAATGTCAATGATT
CTGTTACCAAACAGAAGTTTGATAACTTGTACTGCTGCCGAGAATCCATTTTGGATGGCCTGAAGAGGAC
CACAGATGTGATGTTTGGTGGGAAACAGGTGGTGGTGTGTGGCTATGGTGAGGTAGGAAAGGGCTGCTGT
GCTGCTCTCAAGGCCCTTGGAGCAATTGTCTACATCACAGAAATTGACCCCATCTGTGCTCTGCAGGCCT
GCATGGATGGGTTCCGGGTGGTGAAGCTGAATGAAGTCATCCGGCAGGTGGACGTTGTAATAACTTGCAC
AGGAAATAAGAATGTAGTGACCCGGGAGCACTTGGACCGAATGAAAAATAGTTGCATTGTATGTAATATG
GGCCATTCCAACACAGAAATTGATGTGACCAGCCTCCGCACTCCAGAGCTAACATGGGAGCGCGTACGTT
CTCAGGTGGACCATGTCATCTGGCCTGATGGCAAGCGGGTCGTCCTTCTAGCAGAGGGTCGTTTACTCAA
TTTGAGCTGCTCCACAGTTCCTACCTTTGTCCTTTCCATCACGGCTACAACACAGGCTTTGGCACTGATA
GAACTTTATAATGCACCAGAAGGACGCTACAAACAGGATGTGTACTTGCTTCCTAAGAAAATGGATACTA
ATGGACGTATTACAATGACCAGTCCACACGAACCACGCAACTCTAATAGAGTATTTTTTAAGATAACTTT
TATTTTCTTCTTATTACTTTCCTTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001108561
Insert Size 1428 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001108561.1, NP_001102031.1
RefSeq Size 3435 bp
RefSeq ORF 1428 bp
Locus ID 362013
UniProt ID B5DFN2
Cytogenetics 2q34
Gene Summary Multifaceted cellular regulator which coordinates several essential cellular functions including regulation of epithelial HCO3(-) and fluid secretion, mRNA processing and DNA replication. Regulates ITPR1 sensitivity to inositol 1,4,5-trisphosphate competing for the common binding site and acting as endogenous 'pseudoligand' whose inhibitory activity can be modulated by its phosphorylation status. In the pancreatic and salivary ducts, at resting state, attenuates inositol 1,4,5-trisphosphate-induced calcium release by interacting with ITPR1 (By similarity). When extracellular stimuli induce ITPR1 phosphorylation or inositol 1,4,5-trisphosphate production, dissociates of ITPR1 to interact with CFTR and SLC26A6 mediating their synergistic activation by calcium and cAMP that stimulates the epithelial secretion of electrolytes and fluid (By similarity). Also activates basolateral SLC4A4 isoform 1 to coordinate fluid and HCO3(-) secretion (By similarity). Inhibits the effect of STK39 on SLC4A4 and CFTR by recruiting PP1 phosphatase which activates SLC4A4, SLC26A6 and CFTR through dephosphorylation (By similarity). Mediates the induction of SLC9A3 surface expression produced by Angiotensin-2 (PubMed:20584908). Depending on the cell type, activates SLC9A3 in response to calcium or reverses SLC9A3R2-dependent calcium inhibition. May modulate the polyadenylation state of specific mRNAs, both by controlling the subcellular location of FIP1L1 and by inhibiting PAPOLA activity, in response to a stimulus that alters its phosphorylation state. Acts as a (dATP)-dependent inhibitor of ribonucleotide reductase large subunit RRM1, controlling the endogenous dNTP pool and ensuring normal cell cycle progression (By similarity). In vitro does not exhibit any S-adenosyl-L-homocysteine hydrolase activity (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.