Mapkapk3 (NM_001012127) Rat Untagged Clone

CAT#: RN204033

Mapkapk3 (untagged ORF) - Rat mitogen-activated protein kinase-activated protein kinase 3 (Mapkapk3), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Mapkapk3
• Synonyms: MAPKAP-K3; MK-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN204033 representing NM_001012127
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATGGCGAGACGGCGGGGGAGAAGGGGAGTCTTGTGCCCCAGCCAGGTGCGCTCGGTGCGCCCGCCT
  TGGGCGGTGCTCCGGCCCCAGGTGTGCGACGGGAACCCAAGAAGTACGCGGTGACTGATGACTACCAGTT
  GTCCAAGCAAGTGCTGGGTCTGGGTGTGAACGGCAAGGTACTAGAGTGCTACCATCGGCGCTCTGGGCAG
  AAGTGTGCCTTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTGGACCACCACTGGCAGGCCT
  CAGGCGGCCCCCACATTGTGCGCATCCTGGACGTGTACGAGAACATGCATCACGGCAAGCGCTGCCTCCT
  CATCGTCATGGAATGCATGGAGGGTGGTGAGCTGTTCAGCAGGATTCAGGAGCGCGGTGATCAGGCTTTC
  ACTGAGAGAGAGGCCGCAGAGATAATGCGGGACATTGGCACTGCCATCCAGTTCTTGCACAGCCAGAACA
  TTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTATACATCCAAGGAGAAGGATGCTGTACTTAAACT
  CACTGATTTTGGCTTTGCCAAGGAAACCACCCAAAATGCCCTCCAGACACCCTGTTACACTCCCTATTAT
  GTGGCTCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCGTGCGATATGTGGTCCCTGGGGGTCATCA
  TGTACATCCTTTTGTGTGGATTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCTCCAGGAATGAA
  GAGAAGGATTCGCTTGGGCCAGTATGGCTTCCCTAAACCTGAATGGGCAGACGTCTCTGAGGATGCCAAG
  CAGCTAATCCGTCTGCTCCTGAAGACAGATCCCACCGAGAGGCTGACCATCATGCAGTTTATGAACCATC
  CTTGGATCAATCAATCGATGGAGGTCCCACAGACCCCACTCCATACAGCCCGAGTGCTGGAGGAAGACAA
  AGACCACTGGGATGACGTCAAGGAAGAGATGACCAGTGCCCTGGCCACGATGAGGGTAGACTACGACCAG
  GTGAAAATCAAGGACCTGAAGACCTCTAACAACCGACTCCTCAACAAGCGGAGGAAAAAGCAGGGGGGCA
  GCTCCTCAGCCTCACCGGGATGCAACAACCAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012127
• Insert Size: 1155 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012127.1, NP_001012127.1
• RefSeq Size: 2634 bp
• RefSeq ORF: 1155 bp
• Locus ID: 315994
• UniProt ID: Q66H84
• Cytogenetics: 8q32
• Gene Summary: Stress-activated serine/threonine-protein kinase involved in cytokines production, endocytosis, cell migration, chromatin remodeling and transcriptional regulation. Following stress, it is phosphorylated and activated by MAP kinase p38-alpha/MAPK14, leading to phosphorylation of substrates. Phosphorylates serine in the peptide sequence, Hyd-X-R-X(2)-S, where Hyd is a large hydrophobic residue. MAPKAPK2 and MAPKAPK3, share the same function and substrate specificity, but MAPKAPK3 kinase activity and level in protein expression are lower compared to MAPKAPK2. Phosphorylates HSP27/HSPB1, KRT18, KRT20, RCSD1, RPS6KA3, TAB3 and TTP/ZFP36. Mediates phosphorylation of HSP27/HSPB1 in response to stress, leading to dissociate HSP27/HSPB1 from large small heat-shock protein (sHsps) oligomers and impair their chaperone activities and ability to protect against oxidative stress effectively. Involved in inflammatory response by regulating tumor necrosis factor (TNF) and IL6 production post-transcriptionally: acts by phosphorylating AU-rich elements (AREs)-binding proteins, such as TTP/ZFP36, leading to regulate the stability and translation of TNF and IL6 mRNAs. Phosphorylation of TTP/ZFP36, a major post-transcriptional regulator of TNF, promotes its binding to 14-3-3 proteins and reduces its ARE mRNA affinity leading to inhibition of dependent degradation of ARE-containing transcript. Involved in toll-like receptor signaling pathway (TLR) in dendritic cells: required for acute TLR-induced macropinocytosis by phosphorylating and activating RPS6KA3. Also acts as a modulator of Polycomb-mediated repression (By similarity).[UniProtKB/Swiss-Prot Function]