Nuf2 Mouse qPCR Primer Pair (NM_023284)

CAT#: MP209225

qSTAR qPCR primer pairs against Mus musculus gene Nuf2



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (3)
Nuf2 (Myc-DDK-tagged) - Mouse NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Nuf2)
    • 10 ug

USD 457.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Other products for "Nuf2"

Specifications

Product Data
Gene ID 66977
Forward Sequence CCTCTATGGTCAGAATGCAGCAG
Reverse Sequence ACTGCTTGAACTCCTCTCGCTC
Accession No BC020026, NM_023284, NM_023284.1, NM_023284.2, NM_023284.3
UniProt ID Q99P69
Synonyms 2410003C07Rik; AU044112; C85691; Cdca1; NUF2R
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.