IL28 Receptor alpha (IFNLR1) Human Gene Knockout Kit (CRISPR)
CAT#: KN221789BN
IFNLR1 - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
USD 450.00
USD 457.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | IL28 Receptor alpha |
Locus ID | 163702 |
Components |
KN221789G1, IL28 Receptor alpha gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGCTCCAGGTAAGGGCGCG KN221789G2, IL28 Receptor alpha gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TACCTGGAGCGGCCTGCAGC KN221789BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_170743, NM_173064, NM_173065 |
UniProt ID | Q8IU57 |
Synonyms | CRF2/12; IFNLR; IL-28R1; IL28RA; LICR2 |
Summary | The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN221789 | IFNLR1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN221789LP | IFNLR1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN221789RB | IFNLR1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN421789 | IFNLR1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA116094 | IFNLR1 CRISPRa kit - CRISPR gene activation of human interferon lambda receptor 1 |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review