Human Neurofibromin (NF1) activation kit by CRISPRa

CAT#: GA103178

NF1 CRISPRa kit - CRISPR gene activation of human neurofibromin 1

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: NF1
• Locus ID: 4763
• Kit Components:

  GA103178G1, Neurofibromin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCTAGGTGAGCCCCACGG

  GA103178G2, Neurofibromin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTTAGATGACGTCACCTCC

  GA103178G3, Neurofibromin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAAAAAGCGAGTCCTCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_000267, NM_001042492, NM_001128147
• UniProt ID: P21359
• Synonyms: NFNS; VRNF; WSS
• Summary: This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]