ABI2 (NM_001282932) Human Untagged Clone

CAT#: SC335811

ABI2 (untagged) - Human abl-interactor 2 (ABI2), transcript variant 5


  "NM_001282932" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ABI2 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "ABI2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABI2
Synonyms ABI-2; ABI2B; AblBP3; AIP-1; AIP1; argBP1; argBPIA; argBPIB; SSH3BP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335811 representing NM_001282932.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTTTTAAAAGTTATTTACTTAAAATATCTATACTTAGGCAAATTAGAGGCGTTGATCTTGAGTCG
ACTTTTGTGACCAAATTTGGAAACAATTGCAGTTTGAGATTGAATGAGACAGTTGATATTCATAAAGAG
AAAGTTGCAAGAAGAGAAATTGGTATTTTGACTACCAATAAAAACACTTCAAGGACACATAAGATTATT
GCTCCAGCCAACCTTGAACGACCAGTTCGTTATATTAGAAAACCTATTGACTATACAATTCTAGATGAT
ATTGGACATGGAGTAAAGGTGAGTACCCAGAACATGAAGATGGGTGGGCTGCCGCGTACAACACCTCCA
ACTCAGAAGCCCCCTAGTCCCCCTATGTCAGGGAAAGGGACACTTGGGCGGCACTCCCCCTATCGCACA
CTGGAGCCAGTGCGTCCTCCAGTGGTACCAAATGATTACGTACCTAGCCCAACCCGTAATATGGCTCCC
TCGCAGCAGAGCCCTGTGAGGACAGCTTCTGTGAATCAAAGAAATCGAACTTACAGCAGCAGTGGGAGT
AGTGGAGGGAGCCACCCAAGTAGTCGGAGCAGCAGTCGAGAGAACAGTGGAAGTGGTAGTGTGGGGGTT
CCTATTGCTGTTCCTACTCCATCTCCTCCCAGTGTCTTTCCAGGTCATCCTGTACAGTTCTACAGCATG
AATAGGCCTGCCTCTCGCCATACTCCCCCAACAATAGGGGGCTCGTTGCCCTATAGACGCCCTCCTTCC
ATTACTTCACAAACAAGCCTTCAGAATCAGATGAATGGAGGACCTTTTTATAGCCAGAATCCAGTTTCA
GATACACCACCTCCACCGCCACCTGTGGAAGAACCAGTCTTTGATGAGTCTCCCCCACCTCCTCCTCCT
CCAGAAGATTACGAAGAGGAGGAAGCTGCTGTGGTTGAGTATAGTGATCCTTATGCTGAAGAGGACCCA
CCGTGGGCTCCACGTTCTTACTTGGAAAAGGTTGTGGCAATTTATGACTATACAAAAGACAAGGAAGAT
GAGCTGTCCTTTCAGGAAGGAGCCATTATTTATGTCATCAAGAAGAATGACGATGGTTGGTATGAGGGA
GTTATGAATGGAGTGACTGGGCTTTTTCCTGGGAATTACGTTGAGTCTATCATGCATTATTCTGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282932
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282932.1
RefSeq Size 6643 bp
RefSeq ORF 1173 bp
Locus ID 10152
Cytogenetics 2q33.2
Protein Pathways Regulation of actin cytoskeleton
MW 43.1 kDa
Gene Summary Regulator of actin cytoskeleton dynamics underlying cell motility and adhesion. Functions as a component of the WAVE complex, which activates actin nucleating machinery Arp2/3 to drive lamellipodia formation (PubMed:21107423). Acts as regulator and substrate of nonreceptor tyrosine kinases ABL1 and ABL2 involved in processes linked to cell growth and differentiation. Positively regulates ABL1-mediated phosphorylation of ENAH, which is required for proper polymerization of nucleated actin filaments at the leading edge (PubMed:7590236, PubMed:8649853, PubMed:10498863). Contributes to the regulation of actin assembly at the tips of neuron projections. In particular, controls dendritic spine morphogenesis and may promote dendritic spine specification toward large mushroom-type spines known as repositories of memory in the brain (By similarity). In hippocampal neurons, may mediate actin-dependent BDNF-NTRK2 early endocytic trafficking that triggers dendrite outgrowth (By similarity). Participates in ocular lens morphogenesis, likely by regulating lamellipodia-driven adherens junction formation at the epithelial cell-secondary lens fiber interface (By similarity). Also required for nascent adherens junction assembly in epithelial cells (PubMed:15572692).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in its 5' UTR, differs in the presence and absence of exons in the 5' coding region, initiates translation at an alternate start codon, and lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (e) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.