G protein alpha 12 (GNA12) (NM_001282441) Human Untagged Clone

CAT#: SC335337

GNA12 (untagged) - Human guanine nucleotide binding protein (G protein) alpha 12 (GNA12), transcript variant 3


  "NM_001282441" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


GNA12 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "GNA12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNA12
Synonyms gep; NNX3; RMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335337 representing NM_001282441.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAACGGAGAATGTTTCCCAGGCCGTGCCTAGCAAGGATGCCTGGCAGTCGTGGTTCGGGAAGCACA
CCAGATGGAAACCGAAAGTGCTGCCGTTTTGAGCACCTACTCATTGCACACCCTGGGTCCAGGGGCTCA
AGGGTTCTTGTTGATGCACGAGATAAGCTTGGCATTCCTTGGCAGTATTCTGAAAATGAGAAGCATGGG
ATGTTCCTGATGGCCTTCGAGAACAAGGCGGGGCTGCCTGTGGAGCCGGCCACCTTCCAGCTGTACGTC
CCGGCCCTGAGCGCACTCTGGAGGGATTCTGGCATCAGGGAGGCTTTCAGCCGGAGAAGCGAGTTTCAG
CTGGGGGAGTCGGTGAAGTACTTCCTGGACAACTTGGACCGGATCGGCCAGCTGAATTACTTTCCTAGT
AAGCAAGATATCCTGCTGGCTAGGAAAGCCACCAAGGGAATTGTGGAGCATGACTTCGTTATTAAGAAG
ATCCCCTTTAAGATGGTGGATGTGGGCGGCCAGCGGTCCCAGCGCCAGAAGTGGTTCCAGTGCTTCGAC
GGGATCACGTCCATCCTGTTCATGGTCTCCTCCAGCGAGTACGACCAGGTCCTCATGGAGGACAGGCGC
ACCAACCGGCTGGTGGAGTCCATGAACATCTTCGAGACCATCGTCAACAACAAGCTCTTCTTCAACGTC
TCCATCATTCTCTTCCTCAACAAGATGGACCTCCTGGTGGAGAAGGTGAAGACCGTGAGCATCAAGAAG
CACTTCCCGGACTTCAGGGGCGACCCGCACAGGCTGGAGGACGTCCAGCGCTACCTGGTCCAGTGCTTC
GACAGGAAGAGACGGAACCGCAGCAAGCCACTCTTCCACCACTTCACCACCGCCATCGACACCGAGAAC
GTCCGCTTCGTGTTCCATGCTGTGAAAGACACCATCCTGCAGGAGAACCTGAAGGACATCATGCTGCAG
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282441
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282441.1
RefSeq Size 4374 bp
RefSeq ORF 969 bp
Locus ID 2768
UniProt ID Q03113
Cytogenetics 7p22.3-p22.2
Protein Families Druggable Genome
Protein Pathways Long-term depression, MAPK signaling pathway, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
MW 37.6 kDa
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:22609986, PubMed:15525651, PubMed:15240885, PubMed:17565996, PubMed:12515866, PubMed:16787920, PubMed:16705036, PubMed:23762476, PubMed:27084452). Activates effector molecule RhoA by binding and activating RhoGEFs (ARHGEF12/LARG) (PubMed:15240885, PubMed:12515866, PubMed:16202387). GNA12-dependent Rho signaling subsequently regulates transcription factor AP-1 (activating protein-1) (By similarity). GNA12-dependent Rho signaling also regulates protein phosphatese 2A activation causing dephosphorylation of its target proteins (PubMed:15525651, PubMed:17565996). Promotes tumor cell invasion and metastasis by activating RhoA/ROCK signaling pathway and up-regulating proinflammatory cytokine production (PubMed:23762476, PubMed:16787920, PubMed:16705036, PubMed:27084452). Inhibits CDH1-mediated cell adhesion in process independent from Rho activation (PubMed:11976333, PubMed:16787920). Together with NAPA promotes CDH5 localization to plasma membrane (PubMed:15980433). May play a role in the control of cell migration through the TOR signaling cascade (PubMed:22609986).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus compare to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.