HEXIM2 (NM_001303441) Human Untagged Clone
CAT#: SC335091
HEXIM2 (untagged) - Human hexamethylene bis-acetamide inducible 2 (HEXIM2), transcript variant 7
"NM_001303441" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "HEXIM2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HEXIM2 |
Synonyms | L3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303441, the custom clone sequence may differ by one or more nucleotides
ATGATGGCCACTCCGAACCAGACCGCCTGTAATGCAGAGTCACCAGTGGCCCTGGAGGAGGCCAAGACCT CTGGTGCCCCGGGGAGCCCCCAAACACCCCCTGAGCGTCATGACTCTGGTGGTTCCCTGCCCCTGACACC GCGGATGGAGAGCCACTCAGAGGATGAAGATCTTGCTGGGGCTGTCGGTGGCCTGGGCTGGAACAGTAGG AGTCCCCGGACCCAGAGCCCAGGGGGCTGCTCAGCGGAGGCTGTGCTGGCCCGGAAGAAACACCGTCGGC GGCCATCGAAGCGCAAAAGGCACTGGCGACCCTACCTGGAGCTGAGCTGGGCTGAGAAACAACAGCGGGA TGAGAGGCAGAGCCAGAGGGCCTCCCGGGTCCGCGAAGAGATGTTCGCCAAAGGCCAGCCCGTGGCCCCC TACAACACCACCCAGTTCCTGATGAATGACAGGGACCCGGAGGAGCCCAACTTGGATGTGCCCCATGGGA TCTCCCACCCAGGTTCCAGTGGGGAGAGTGAGGCCGGGGACAGTGATGGGCGGGGCCGAGCGCACGGTGA GTTCCAGCGGAAGGACTTCTCTGAGACTTACGAACGCTTCCACACCGAGAGCCTGCAGGGCCGCAGCAAG CAGGAGCTGGTGCGAGACTACCTGGAGCTGGAGAAGCGGCTGTCGCAGGCGGAGGAGGAGACTAGGAGGC TGCAGCAGCTGCAGGCGTGCACCGGCCAGCAGTCCTGCCGCCAGGTGGAGGAGCTGGCTGCCGAGGTCCA GAGGCTCCGGACCGAAAACCAGCGGCTTCGTCAGGAGAACCAGATGTGGAACCGAGAGGGCTGCCGCTGT GATGAGGAGCCGGGTACCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303441 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001303441.1, NP_001290370.1 |
RefSeq Size | 1488 bp |
RefSeq ORF | 861 bp |
Locus ID | 124790 |
UniProt ID | Q96MH2 |
Cytogenetics | 17q21.31 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the HEXIM family of proteins. This protein is a component of the 7SK small nuclear ribonucleoprotein. This protein has been found to negatively regulate the kinase activity of the cyclin-dependent kinase P-TEFb, which phosphorylates multiple target proteins to promote transcriptional elongation. This gene is located approximately 7 kb downstream from related family member HEXIM1 on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (7) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.