ALDH3B1 (NM_001290059) Human Untagged Clone
CAT#: SC334965
ALDH3B1 (untagged) - Human aldehyde dehydrogenase 3 family, member B1 (ALDH3B1), transcript variant 5
"NM_001290059" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "ALDH3B1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALDH3B1 |
Synonyms | ALDH4; ALDH7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290059, the custom clone sequence may differ by one or more nucleotides
ATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGG ACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGAC CTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGC ACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAAC AGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGA TCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTC GGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGA AGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAG CGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGT GCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCC TGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGAT GCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCACACTGCTCTGA |
Restriction Sites | AscI-MluI |
ACCN | NM_001290059 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290059.1, NP_001276988.1 |
RefSeq Size | 2774 bp |
RefSeq ORF | 819 bp |
Locus ID | 221 |
UniProt ID | P43353 |
Cytogenetics | 11q13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Drug metabolism - cytochrome P450, Glycolysis / Gluconeogenesis, Histidine metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Phenylalanine metabolism, Tyrosine metabolism |
Gene Summary | This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (5) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.