SLC35C2 (NM_001281459) Human Untagged Clone

CAT#: SC334635

SLC35C2 (untagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 6


  "NM_001281459" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-Slc35c2 Antibody
    • 100 ul

USD 539.00

Other products for "SLC35C2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC35C2
Synonyms BA394O2.1; C20orf5; CGI-15; OVCOV1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281459, the custom clone sequence may differ by one or more nucleotides


ATGACCAAATCCTCAGCTGTCCTCTTCATCTTGATCTTCTCTCTGATCTTCAAGCTGGAGGAGCTGTCCA
CACAGTTCAACGTGGAGGGCTTCGCCTTGGTGCTGGGGGCCTCGTTCATCGGTGGCATTCGCTGGACCCT
CACCCAGATGCTCCTGCAGAAGGCTGAACTCGGCCTCCAGAATCCCATCGACACCATGTTCCACCTGCAG
CCACTCATGTTCCTGGGGCTCTTCCCTCTCTTTGCTGTATTTGAAGGTCTCCATTTGTCCACATCTGAGA
AAATCTTCCGTTTCCAGGACACAGGGCTGCTCCTGCGGGTACTTGGGAGCCTCTTCCTTGGCGGGATTCT
CGCCTTTGGTTTGGGCTTCTCTGAGTTCCTCCTGGTCTCCAGAACCTCCAGCCTCACTCTCTCCATTGCC
GGCATTTTTAAGGAAGTCTGCACTTTGCTGTTGGCAGCTCATCTGCTGGGCGATCAGATCAGCCTCCTGA
ACTGGCTGGGCTTCGCCCTCTGCCTCTCGGGAATATCCCTCCACGTTGCCCTCAAAGCCCTGCATTCCAG
AGGTGATGGTGGCCCCAAGGCCTTGAAGGGGCTGGGCTCCAGCCCCGACCTGGAGCTGCTGCTCCGGAGC
AGCCAGCGGGAGGAAGGTGACAATGAGGAGGAGGAGTACTTTGTGGCCCAGGGGCAGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281459
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281459.1, NP_001268388.1
RefSeq Size 2191 bp
RefSeq ORF 693 bp
Locus ID 51006
UniProt ID Q9NQQ7
Cytogenetics 20q13.12
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the triose-phosphate transporter protein family. This gene is regulated by oxygen tension, is induced in hypoxic trophoblast cells, and is overexpressed in ovarian cancer. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (6) has multiple differences in the 5' UTR and 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (e) is shorter, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.