GRCC10 (C12orf57) (NM_001301834) Human Untagged Clone
CAT#: SC333731
C12orf57 (untagged) - Human chromosome 12 open reading frame 57 (C12orf57), transcript variant 2
"NM_001301834" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (3)
Other products for "GRCC10"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GRCC10 |
Synonyms | C10; GRCC10 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333731 representing NM_001301834.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGTCCGCCTCGACCCAACCGGCGGCCTTGAGCGCTGAGCAAGCAAAGGTGGTCCTCGCGGAGGTG ATCCAGGCGTTCTCCGCCCCGGAGAATGCAGTGCGCATGGACGAGGCTCGGGATAACGCCTGCAACGAC ATGGGTAAGATGCTGCAATTCGTGCTGCCCGTGGCCACGCAGATCCAGCAGGAGGTTATCAAAGCCTAT GGCTTCAGCTGCGACGGGGAAGGTGTCCTTAAGTTTGCTCGCTTGGTCAAGTCCTACGAAGCCCAGGAT CCTGAGATCGCCAGCCTGTCAGGCAAGCTGAAGGCGCTGTTTCTGCCGCCCATGACCCTGCCACCCCAT GGGCCTGCTGCTGGTGGCAGCGTGGCCGCCTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301834 |
Insert Size | 381 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301834.1 |
RefSeq Size | 665 bp |
RefSeq ORF | 381 bp |
Locus ID | 113246 |
UniProt ID | Q99622 |
Cytogenetics | 12p13.31 |
MW | 13.2 kDa |
Gene Summary | This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) differs in the 5' UTR and encodes the same isoform (1), compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.