zinc finger protein 138 (ZNF138) (NM_001271640) Human Untagged Clone
CAT#: SC333487
ZNF138 (untagged) - Human zinc finger protein 138 (ZNF138), transcript variant 9
"NM_001271640" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "zinc finger protein 138"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | zinc finger protein 138 |
Synonyms | pHZ-32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333487 representing NM_001271640.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGACCACTGACATTTATGGATGTGGCCATAGAGTTCTCTTTGGAGGAGTGGCAGTGCCTGGACACT GCACAGCGGAATGTATATAGGCATGTGATGTTAGAGAACTACAGAAACCTGGTTTTCTTGGCTGTAGCA TTTACCTTTGATCTCAGTGGACTCAACATTTTGTCATTCCAAAGTATCCTGCCATTTGTTTCAGCACTT TATGTCATGGGAAACAGAAACCAGTGTCTGCAAAAGCACCTAGAAGCCAGAAATAAAGATCTCTGTGTT CTCGTTTTGCCCAAGACCTTTGGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271640 |
Insert Size | 303 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271640.1 |
RefSeq Size | 2679 bp |
RefSeq ORF | 303 bp |
Locus ID | 7697 |
Cytogenetics | 7q11.21 |
Protein Families | Transcription Factors |
MW | 11.5 kDa |
Gene Summary | May be involved in transcriptional regulation as a repressor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (9) includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (7) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.