IFI27 (NM_001288959) Human Untagged Clone
CAT#: SC333390
IFI27 (untagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 8
"NM_001288959" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "IFI27"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFI27 |
Synonyms | FAM14D; ISG12; ISG12A; P27 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333390 representing NM_001288959.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCTGTGCCCATGGTGCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATA GCAGCCAAGATGATGTCCGCGGCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCT ACTCTGCAGTCACTGGGAGCAACTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCT GCCATTGCGGCTGTCATTGCGAGGTTCTACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288959 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001288959.1 |
RefSeq Size | 532 bp |
RefSeq ORF | 240 bp |
Locus ID | 3429 |
UniProt ID | P40305 |
Cytogenetics | 14q32.12 |
Protein Families | Transmembrane |
MW | 7.5 kDa |
Gene Summary | Probable adapter protein involved in different biological processes (PubMed:22427340, PubMed:27194766). Part of the signaling pathways that lead to apoptosis (PubMed:18330707, PubMed:27673746, PubMed:24970806). Involved in type-I interferon-induced apoptosis characterized by a rapid and robust release of cytochrome C from the mitochondria and activation of BAX and caspases 2, 3, 6, 8 and 9 (PubMed:18330707, PubMed:27673746). Also functions in TNFSF10-induced apoptosis (PubMed:24970806). May also have a function in the nucleus, where it may be involved in the interferon-induced negative regulation of the transcriptional activity of NR4A1, NR4A2 and NR4A3 through the enhancement of XPO1-mediated nuclear export of these nuclear receptors (PubMed:22427340). May thereby play a role in the vascular response to injury (By similarity). In the innate immune response, has an antiviral activity towards hepatitis C virus/HCV (PubMed:27194766, PubMed:27777077). May prevent the replication of the virus by recruiting both the hepatitis C virus non-structural protein 5A/NS5A and the ubiquitination machinery via SKP2, promoting the ubiquitin-mediated proteasomal degradation of NS5A (PubMed:27194766, PubMed:27777077).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) lacks an internal exon in the 5' region which results in translation initiation at a downstream AUG codon, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, compared to isoform 1. This variant corresponds to the allele present in the GRC reference assembly. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.