C6orf48 (NM_001287488) Human Untagged Clone

CAT#: SC333371

C6orf48 (untagged) - Human chromosome 6 open reading frame 48 (C6orf48), transcript variant 9


  "NM_001287488" in other vectors (2)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "C6orf48"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C6orf48
Synonyms D6S57; G8
Vector pCMV6-Entry
Sequence Data
>SC333371 representing NM_001287488.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGAGAAGCTTTGTATGGCTGTCATGCTTAGACAGTGATTCCTGCAACTTGACCTTCAGGCTGGGA
GAGGTGGAGAGCCATGCCTGTTCTCCTTCCTTGCTATGGAATTTGCTGACACAATATCTTCCGCCTGGT
GCTGGGCATATCCTAAGAACTTACAACTTTCCTGTATTATCCTGTGTGAGCAGCTGTCACCTTATTGGG
GGAAAAATGCCTGAAAATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001287488
Insert Size 228 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287488.1
RefSeq Size 496 bp
RefSeq ORF 228 bp
Locus ID 50854
Cytogenetics 6p21.33
MW 8.3 kDa

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.