C6ORF182 (CEP57L1) (NM_001271853) Human Untagged Clone

CAT#: SC333140

CEP57L1 (untagged) - Homo sapiens centrosomal protein 57kDa-like 1 (CEP57L1), transcript variant 4


  "NM_001271853" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit polyclonal Anti-C6orf182 Antibody
    • 100 ul

USD 539.00

Other products for "C6ORF182"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C6ORF182
Synonyms bA487F23.2; C6orf182; cep57R
Vector pCMV6-Entry
Sequence Data
>SC333140 representing NM_001271853.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATTCTGAATTAATGCATAGTATAGTAGGAAGCTATCATAAACCTCCAGAAAGAGTATTTGTTCCC
TCATTCACCCAGAATGAACCATCTCAGAATTGCCATCCTGCAAACTTAGAAGTTACCTCTCCTAAGATA
CTTCATAGCCCAAATAGCCAAGCTCTTATTTTAGCCTTAAAAACTCTTCAGGAAAAAATTCATCGTTTA
GAGCTGGAGAGAACACAAGCTGAAGATAACCTGAACATTCTTTCCAGAGAAGCAGCACAGTATAAGAAG
GCCTTAGAGAATGAAACAAATGAGAGAAATCTGGCACACCAGGAGCTGATAAAGCAGAAAAAAGATATA
AGTATACAGTTAAGCTCAGCCCAGTCTCGTTGTACTCTTCTAGAGAAGCAACTAGAATATACAAAGAGA
ATGGTTCTCAACGTAGAGCGAGAAAAGAACATGATCCTAGAACAACAGGCCCAGCTTCAGAGGGAAAAA
GAACAAGATCAGATGAAGCTGTATGCAAAACTTGAAAAGCTTGATGTCTTAGAAAAAGAGTGTTTCAGA
CTTACAACAACTCAGAAAACTGCTGAGGACAAGATTAAACATTTAGAAGAAAAACTTAAGGAAGAAGAA
CATCAGCGTAAGCTATTTCAAGACAAAGCTTCTGAGCTTCAAACTGGACTTGAAATCAGTAAAATTATA
ATGTCTTCAGTTTCAAATCTAAAGCACTCCAAGGAAAAGAAGAAATCTTCAAAGAAAACTAAATGTATA
AAGAGACGACCACCTTGGCAAATTTGTTCAAAGTTTGGAGCACTGCCTTTTGTGGCTGAAAAGATGAGG
CAACATCGTGACCCACATATCCTTCAGAAACCTTTTAACGTGACTGAGACTAGATGTCTCCCCAAGCCT
TCTAGAACAACTTCCTGGTGTAAAGCTATTCCTCCTGACTCAGAAAAGTCCATTTCCATTTGTGACAAT
TTATCTGAACTTTTGATGGCAATGCAAGATGAGCTGGACCAAATGAGCATGGAGCACCAAGAACTACTG
AAACAAATGAAGGAAACTGAAAGTCATTCAGTCTGTGACGACATAGAATGTGAACTAGAGTGTTTACTC
AAGAAAATGGAAATTAAAGGAGAACAAATCTCCAAACTGAAGAAGCATCAAGACAGTGTAAGAAGGCTT
TAG

Restriction Sites SgfI-MluI     
ACCN NM_001271853
Insert Size 1176 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271853.1
RefSeq Size 2765 bp
RefSeq ORF 1176 bp
Locus ID 285753
UniProt ID Q8IYX8
Cytogenetics 6q21
MW 45.6 kDa
Gene Summary Centrosomal protein which may be required for microtubule attachment to centrosomes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.