HTR2C (NM_001256761) Human Untagged Clone
CAT#: SC332469
HTR2C (untagged) - Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled (HTR2C), transcript variant 3
"NM_001256761" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HTR2C |
Synonyms | 5-HT1C; 5-HT2C; 5-HTR2C; 5HTR2C; HTR1C |
Vector | pCMV6-Entry |
Sequence Data |
>SC332469 representing NM_001256761.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTGAACCTGAGGAATGCGGTGCATTCATTCCTTGTGCACCTAATTGGCCTATTGGTTTGGCAATGT GATATTTCTGTGAGCCCAGTAGCAGCTATAGTAACTGACATTTTCAATACCTCCGATGGTGGACGCTTC AAATTCCCAGACGGGGTACAAAACTGGCCAGCACTTTCAATCGTCATCATAATAATCATGACAATAGGT GGCAACATCCTTGTGATCATGGCAGTAAGCATGGAAAAGAAACTGCACAATGCCACCAATTACTTCTTA ATGTCCCTAGCCATTGCTGATATGCTAGTGGGACTACTTGTCATGCCCCTGTCTCTCCTGGCAATCCTT TATGATTATGTCTGGCCACTACCTAGATATTTGTGCCCCGTCTGGATTTCTTTAGATGTTTTATTTTCA ACAGCGTCCATCATGCACCTCTGCGCTATATCGCTGGATCGGTGTATCAGTTCCTATCCCTGTGATTGG ACTGAGGGACGAAGAAAAGGTGTTCGTGAACAACACGACGTGCGTGCTCAACGACCCAAATTTCGTTCT TATTGGGTCCTTCGTAGCTTTCTTCATACCGCTGACGATTATGGTGATTACGTATTGCCTGACCATCTA CGTTCTGCGCCGACAAGCTTTGATGTTACTGCACGGCCACACCGAGGAACCGCCTGGACTAAGTCTGGA TTTCCTGAAGTGCTGCAAGAGGAATACGGCCGAGGAAGAGAACTCTGCAAACCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256761 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256761.1 |
RefSeq Size | 4679 bp |
RefSeq ORF | 747 bp |
Locus ID | 3358 |
UniProt ID | P28335 |
Cytogenetics | Xq23 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Gap junction, Neuroactive ligand-receptor interaction |
MW | 28.1 kDa |
Gene Summary | This gene encodes a seven-transmembrane G-protein-coupled receptor. The encoded protein responds to signaling through the neurotransmitter serotonin. The mRNA of this gene is subject to multiple RNA editing events, where adenosine residues encoded by the genome are converted to inosines. RNA editing is predicted to alter the structure of the second intracellular loop, thereby generating alternate protein forms with decreased ability to interact with G proteins. Abnormalities in RNA editing of this gene have been detected in victims of suicide that suffer from depression. In addition, naturally-occuring variation in the promoter and 5' non-coding and coding regions of this gene may show statistically-significant association with mental illness and behavioral disorders. Alternative splicing results in multiple different transcript variants. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (3, also known as 5-HT2C-tr) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233545 | HTR2C (Myc-DDK tagged) - Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled (HTR2C), transcript variant 3 |
USD 330.00 |
|
RG233545 | HTR2C (tGFP-tagged) - Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled (HTR2C), transcript variant 3 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review