CMPK2 (NM_001256478) Human Untagged Clone

CAT#: SC332394

CMPK2 (untagged) - Homo sapiens cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial (CMPK2), transcript variant 3


  "NM_001256478" in other vectors (2)

Reconstitution Protocol

USD 503.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal CMPK2 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CMPK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CMPK2
Synonyms NDK; TMPK2; TYKi; UMP-CMPK2
Vector pCMV6-Entry
Sequence Data
>SC332394 representing NM_001256478.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTTCGCCCGCCGGCTCCTGCGCGGGCCACTGTCGGGGCCGCTGCTCGGGCGGCGCGGGGTCTGC
GCTGGGGCCATGGCTCCGCCGCGCCGCTTCGTCCTGGAGCTTCCCGACTGCACCCTGGCTCACTTCGCC
CTAGGCGCCGACGCCCCCGGCGACGCAGACGCCCCCGACCCCCGCCTGGCGGCGCTGCTGGGGCCCCCG
GAGCGCAGCTACTCGCTGTGCGTGCCCGTGACCCCGGACGCCGGCTGCGGGGCCCGGGTCCGGGCGGCG
CGGCTGCACCAGCGCCTGCTGCACCAGCTGCGCCGCGGCCCCTTCCAGCGGTGCCAGCTGCTCAGGCTG
CTCTGCTACTGCCCGGGCGGCCAGGCCGGCGGCGCACAGCAAGGCTTCCTGCTGCGCGACCCCCTGGAT
GACCCTGACACCCGGCAAGCGCTGCTCGAGCTGCTGGGCGCCTGTCAGGAGGCACCACGCCCGCACTTG
GGCGAGTTCGAGGCCGACCCGCGCGGCCAGCTGTGGCAGCGCCTCTGGGAGGTGCAAGACGGCAGGCGG
CTGCAGGTGGGCTGCGCACAGGTCGTGCCCGTCCCGGAGCCCCCGCTGCACCCGGTGGTGCCAGACTTG
CCCAGTTCCGTGGTCTTCCCGGACCGGGAAGCCGCCCGGGCCGTTTTGGAGGAGTGTACCTCCTTTATT
CCTGAAGCCCGGGCAGTGCTTGACCTGGTCGACCAGTGCCCAAAACAGATCCAGAAAGGAAAGTTCCAG
GTTGTTGCCATCGAAGGACTGGATGCCACGGGTAAAACCACGGTGACCCAGTCAGTGGCAGATTCACTT
AAGGCTGTCCTCTTAAAGTCACCACCCTCTTGCATTGGCCAGTGGAGGAAGATCTTTGATGATGAACCA
ACTATCATTAGAAGAGCTTTTTACTCTTTGGGCAATTATATTGTGGCCTCCGAAATAGCTAAAGAATCT
GCCAAATCTCCTGTGATTGTAGACAGGTCCCAGCTGGGAGGAACCTTATACCATCCTTCTCTCCACCTG
CTCGGCAGTGAAGTTTGTGGGACTGGAATCTTGGATTCATCACACTCGAGTCAAGGCCTGGAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256478
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256478.1
RefSeq Size 1241 bp
RefSeq ORF 1101 bp
Locus ID 129607
UniProt ID Q5EBM0
Cytogenetics 2p25.2
Protein Pathways Metabolic pathways, Pyrimidine metabolism
MW 39.6 kDa
Gene Summary This gene encodes one of the enzymes in the nucleotide synthesis salvage pathway that may participate in terminal differentiation of monocytic cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (3) lacks two exons in the 3' coding region, and differs in the 3' UTR and coding region compared to variant 1. The resulting protein (isoform 3) has a shorter C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.