CHST12 (NM_001243794) Human Untagged Clone

CAT#: SC332043

CHST12 (untagged) - Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 12 (CHST12), transcript variant 1


  "NM_001243794" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CHST12 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CHST12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHST12
Synonyms C4S-2; C4ST-2; C4ST2
Vector pCMV6-Entry
Sequence Data
>SC332043 representing NM_001243794.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCAAGGCCCGGCTGTTCCGGCTGTGGCTGGTGCTGGGGTCGGTGTTCATGATCCTGCTGATCATC
GTGTACTGGGACAGCGCAGGCGCCGCGCACTTCTACTTGCACACGTCCTTCTCTAGGCCGCACACGGGG
CCGCCGCTGCCCACGCCCGGGCCGGACAGGGACAGGGAGCTCACGGCCGACTCCGATGTCGACGAGTTT
CTGGACAAGTTTCTCAGTGCTGGCGTGAAGCAGAGCGACCTTCCCAGAAAGGAGACGGAGCAGCCGCCT
GCGCCGGGGAGCATGGAGGAGAGCGTGAGAGGCTACGACTGGTCCCCGCGCGACGCCCGGCGCAGCCCA
GACCAGGGCCGGCAGCAGGCGGAGCGGAGGAGCGTGCTGCGGGGCTTCTGCGCCAACTCCAGCCTGGCC
TTCCCCACCAAGGAGCGCGCATTCGACGACATCCCCAACTCGGAGCTGAGCCACCTGATCGTGGACGAC
CGGCACGGGGCCATCTACTGCTACGTGCCCAAGGTGGCCTGCACCAACTGGAAGCGCGTGATGATCGTG
CTGAGCGGAAGCCTGCTGCACCGCGGTGCGCCCTACCGCGACCCGCTGCGCATCCCGCGCGAGCACGTG
CACAACGCCAGCGCGCACCTGACCTTCAACAAGTTCTGGCGCCGCTACGGGAAGCTCTCCCGCCACCTC
ATGAAGGTCAAGCTCAAGAAGTACACCAAGTTCCTCTTCGTGCGCGACCCCTTCGTGCGCCTGATCTCC
GCCTTCCGCAGCAAGTTCGAGCTGGAGAACGAGGAGTTCTACCGCAAGTTCGCCGTGCCCATGCTGCGG
CTGTACGCCAACCACACCAGCCTGCCCGCCTCGGCGCGCGAGGCCTTCCGCGCTGGCCTCAAGGTGTCC
TTCGCCAACTTCATCCAGTACCTGCTGGACCCGCACACGGAGAAGCTGGCGCCCTTCAACGAGCACTGG
CGGCAGGTGTACCGCCTCTGCCACCCGTGCCAGATCGACTACGACTTCGTGGGGAAGCTGGAGACTCTG
GACGAGGACGCCGCGCAGCTGCTGCAGCTACTCCAGGTGGACCGGCAGCTCCGCTTCCCCCCGAGCTAC
CGGAACAGGACCGCCAGCAGCTGGGAGGAGGACTGGTTCGCCAAGATCCCCCTGGCCTGGAGGCAGCAG
CTGTATAAACTCTACGAGGCCGACTTTGTTCTCTTCGGCTACCCCAAGCCCGAAAACCTCCTCCGAGAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001243794
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243794.1
RefSeq Size 2131 bp
RefSeq ORF 1245 bp
Locus ID 55501
UniProt ID Q9NRB3
Cytogenetics 7p22.3
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Sulfur metabolism
MW 48.4 kDa
Gene Summary The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin and desulfated dermatan sulfate. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. Alternatively spliced transcript variants differing only in their 5' UTRs have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the predominant transcript. Variants 1-3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.