NDRG4 (NM_001242835) Human Untagged Clone

CAT#: SC331893

NDRG4 (untagged) - Homo sapiens NDRG family member 4 (NDRG4), transcript variant 6


  "NM_001242835" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-NDRG4 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NDRG4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDRG4
Synonyms BDM1; SMAP-8; SMAP8
Vector pCMV6-Entry
Sequence Data
>SC331893 representing NM_001242835.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCGGAGTGCTGGGATGGGGAACATGACATCGAGACACCCTACGGCCTTCTGCATGTAGTGATCCGG
GGCTCCCCCAAGGGGAACCGCCCAGCCATCCTCACCTACCATGATGTGGGCCTCAACCACAAACTATGC
TTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGTCACGTGGAT
GCCCCTGGACAACAGGTGGGGGCGTCGCAGTTTCCTCAGGGGTACCAGTTCCCCTCCATGGAGCAGCTG
GCTGCCATGCTCCCCAGCGTGGTGCAGCATTTCGGGTTCAAGTATGTGATTGGCATCGGAGTGGGCGCC
GGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCCGACCTGGTGGAGGGGCTGGTGCTGGTGAAC
ATCGACCCCAATGGCAAAGGCTGGATAGACTGGGCTGCCACCAAGCTCTCCGGCCTAACTAGCACTTTA
CCCGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACAGAGTTGGTGCAGAGC
TACCGGCAGCAGATTGGGAACGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGC
CGCAGAGACCTGGACATTAACCGGCCTGGAACGGTGCCCAATGCCAAGACGCTCCGCTGCCCCGTGATG
CTGGTGGTTGGGGATAATGCACCCGCTGAGGACGGGGTGGTGGAGTGCAACTCCAAACTGGACCCGACC
ACTACGACCTTCCTGAAGATGGCAGACTCTGGAGGGCTGCCCCAGGTCACACAGCCAGGGAAGCTGACT
GAAGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATTGCGTACTTGAAGGACCGAAGGCTGAGTGGA
GGAGCAGTGCCCTCAGCCAGCATGACCCGCCTGGCACGCTCCCGCACTGCATCCCTCACCAGTGCCAGC
TCGGTGGATGGCAGCCGCCCACAGGCCTGCACCCACTCAGAGAGCAGCGAGGGGCTGGGCCAGGTCAAC
CACACCATGGAGGTGTCCTGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242835
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242835.1
RefSeq Size 3229 bp
RefSeq ORF 1059 bp
Locus ID 65009
UniProt ID Q9ULP0
Cytogenetics 16q21
MW 38.5 kDa
Gene Summary This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (6) has multiple differences at the 5' end which result in the use of a distinct translation initiation codon and an additional exon in the 3' coding region, compared to variant 2. The encoded protein (isoform 6; also known as NDRG4-Bvar) has a shorter and distinct N-terminus and longer C-terminus, compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.