FLI1 (NM_001271012) Human Untagged Clone

CAT#: SC330911

FLI1 (untagged) - Homo sapiens Fli-1 proto-oncogene, ETS transcription factor (FLI1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FLI1
• Synonyms: BDPLT21; EWSR2; SIC-1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330911 representing NM_001271012.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGATCCAGGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTC
  AAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAAC
  AAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCCCCAGCCAGATCCG
  TATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAA
  TTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAG
  TTCAAAATGACGGACCCCGATGAGGTGGCCAGGCGCTGGGGCGAGCGGAAAAGCAAGCCCAACATGAAT
  TACGACAAGCTGAGCCGGGCCCTCCGTTATTACTATGATAAAAACATTATGACCAAAGTGCACGGCAAA
  AGATATGCTTACAAATTTGACTTCCACGGCATTGCCCAGGCTCTGCAGCCACATCCGACCGAGTCGTCC
  ATGTACAAGTACCCTTCTGACATCTCCTACATGCCTTCCTACCATGCCCACCAGCAGAAGGTGAACTTT
  GTCCCTCCCCATCCATCCTCCATGCCTGTCACTTCCTCCAGCTTCTTTGGAGCCGCATCACAATACTGG
  ACCTCCCCCACGGGGGGAATCTACCCCAACCCCAACGTCCCCCGCCATCCTAACACCCACGTGCCTTCA
  CACTTAGGCAGCTACTACTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271012
• Insert Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271012.1
• RefSeq Size: 3442 bp
• RefSeq ORF: 780 bp
• Locus ID: 2313
• UniProt ID: Q01543
• Cytogenetics: 11q24.3
• Protein Families: Transcription Factors
• MW: 29.1 kDa
• Gene Summary: This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and two alternate internal exons, and uses an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.