TRAPPC6A (NM_001270892) Human Untagged Clone

CAT#: SC330886

TRAPPC6A (untagged) - Homo sapiens trafficking protein particle complex 6A (TRAPPC6A), transcript variant 3


  "NM_001270892" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TRAPPC6A Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TRAPPC6A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRAPPC6A
Synonyms TRS33
Vector pCMV6-Entry
Sequence Data
>SC330886 representing NM_001270892.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGATACTGTGTTGTTTGAGTTTCTTCACACGGAGATGGTGGCTGAGCTGTGGGCTCACGACCCC
GACCCCGGCCCGGGGGTGAGCGCCGGGCTCCGTGGGGAGGAAGCGGGGGCCACCAAGGCTGCCCCGGGA
GACGCTGGCCTTCAGGGAGGAGCTGGATGTCCTCAAGTTCTTGTGCAAAGACCTGTGGGTGGCGGTGTT
CCAGAAGCAGATGGACAGCCTGCGCACCAATCACCAGGGGACCTACGTCCTGCAAGACAACAGCTTCCC
CCTCCTCCTCCCGATGGCCTCTGGCCTGCAGTATCTGGAGGAAGCACCCAAGTTCCTGGCCTTCACCTG
CGGCCTCCTGCGCGGCGCCCTCTATACCCTGGGCATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270892
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270892.1
RefSeq Size 770 bp
RefSeq ORF 384 bp
Locus ID 79090
UniProt ID O75865
Cytogenetics 19q13.32
MW 13 kDa
Gene Summary This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. Loss of expression of the related gene in mouse affects coat and eye pigmentation, suggesting that the encoded protein may be involved in melanosome biogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.