TRAPPC6A (NM_001270892) Human Untagged Clone
CAT#: SC330886
TRAPPC6A (untagged) - Homo sapiens trafficking protein particle complex 6A (TRAPPC6A), transcript variant 3
"NM_001270892" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "TRAPPC6A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRAPPC6A |
Synonyms | TRS33 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330886 representing NM_001270892.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGGATACTGTGTTGTTTGAGTTTCTTCACACGGAGATGGTGGCTGAGCTGTGGGCTCACGACCCC GACCCCGGCCCGGGGGTGAGCGCCGGGCTCCGTGGGGAGGAAGCGGGGGCCACCAAGGCTGCCCCGGGA GACGCTGGCCTTCAGGGAGGAGCTGGATGTCCTCAAGTTCTTGTGCAAAGACCTGTGGGTGGCGGTGTT CCAGAAGCAGATGGACAGCCTGCGCACCAATCACCAGGGGACCTACGTCCTGCAAGACAACAGCTTCCC CCTCCTCCTCCCGATGGCCTCTGGCCTGCAGTATCTGGAGGAAGCACCCAAGTTCCTGGCCTTCACCTG CGGCCTCCTGCGCGGCGCCCTCTATACCCTGGGCATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270892 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270892.1 |
RefSeq Size | 770 bp |
RefSeq ORF | 384 bp |
Locus ID | 79090 |
UniProt ID | O75865 |
Cytogenetics | 19q13.32 |
MW | 13 kDa |
Gene Summary | This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. Loss of expression of the related gene in mouse affects coat and eye pigmentation, suggesting that the encoded protein may be involved in melanosome biogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.