CA6 (NM_001270502) Human Untagged Clone
CAT#: SC330855
CA6 (untagged) - Homo sapiens carbonic anhydrase VI (CA6), transcript variant 4
"NM_001270502" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (3)
Other products for "CA6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CA6 |
Synonyms | CA-VI; GUSTIN |
Vector | pCMV6-Entry |
Sequence Data |
>SC330855 representing NM_001270502.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTGTCTGACTGGACCTACTCAGATTCACATTGTTCACTACAATTCTAAATACAAGAGCTATGATATA GCCCAAGATGCGCCGGATGGTTTGGCTGTACTGGCAGCCTTCGTTGAGGTGAAGAATTACCCTGAAAAC ACTTATTACAGCAACTTCATTTCTCATCTGGCCAACATCAAGTACCCAGGACAAAGAACAACCCTGACT GGCCTTGACGTTCAGGACATGCTGCCCAGGAACCTCCAGCACTACTACACCTACCATGGCTCACTCACC ACGCCTCCCTGCACTGAGAACGTCCACTGGTTTGTGCTGGCAGATTTTGTCAAGCTCTCCAGGACACAG GTTTGGAAGCTGGAGAATTCCTTACTGGATCACCGCAACAAGACCATCCACAACGATTACCGCAGGACC CAGCCCCTGAACCACAGAGTGGTGGAATCCAACTTCCCGAATCAGGAATACACTCTAGGCTCTGAATTC CAGTTTTACCTACATAAGATTGAGGAAATTCTTGACTACTTAAGAAGAGCATTGAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270502 |
Insert Size | 543 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270502.1 |
RefSeq Size | 1049 bp |
RefSeq ORF | 543 bp |
Locus ID | 765 |
Cytogenetics | 1p36.23 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Nitrogen metabolism |
MW | 21.2 kDa |
Gene Summary | The protein encoded by this gene is one of several isozymes of carbonic anhydrase. This protein is found only in salivary glands and saliva and protein may play a role in the reversible hydratation of carbon dioxide though its function in saliva is unknown. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks two consecutive exons in the 5' coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.