T (NM_001270484) Human Untagged Clone
CAT#: SC330850
T (untagged) - Homo sapiens T, brachyury homolog (mouse) (T), transcript variant 2
"NM_001270484" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "T"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | T |
Synonyms | SAVA; T; TFT |
Vector | pCMV6-Entry |
Sequence Data |
>SC330850 representing NM_001270484.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCTCCCCTGGCACCGAGAGCGCGGGAAAGAGCCTGCAGTACCGAGTGGACCACCTGCTGAGCGCC GTGGAGAATGAGCTGCAGGCGGGCAGCGAGAAGGGCGACCCCACAGAGCGCGAACTGCGCGTGGGCCTG GAGGAGAGCGAGCTGTGGCTGCGCTTCAAGGAGCTCACCAATGAGATGATCGTGACCAAGAACGGCAGG AGGATGTTTCCGGTGCTGAAGGTGAACGTGTCTGGCCTGGACCCCAACGCCATGTACTCCTTCCTGCTG GACTTCGTGGCGGCGGACAACCACCGCTGGAAGTACGTGAACGGGGAATGGGTGCCGGGGGGCAAGCCG GAGCCGCAGGCGCCCAGCTGCGTCTACATCCACCCCGACTCGCCCAACTTCGGGGCCCACTGGATGAAG GCTCCCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAAC TCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGC CACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAA ATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATG GAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATCCTATTCTGACAACTCACCTGCATGTTTA TCCATGCTGCAATCCCATGACAATTGGTCCAGCCTTGGAATGCCTGCCCATCCCAGCATGCTCCCCGTG AGCCACAATGCCAGCCCACCTACCAGCTCCAGTCAGTACCCCAGCCTGTGGTCTGTGAGCAACGGCGCC GTCACCCCGGGCTCCCAGGCAGCAGCCGTGTCCAACGGGCTGGGGGCCCAGTTCTTCCGGGGCTCCCCC GCGCACTACACACCCCTCACCCATCCGGTCTCGGCGCCCTCTTCCTCGGGATCCCCACTGTACGAAGGG GCGGCCGCGGCCACAGACATCGTGGACAGCCAGTACGACGCCGCAGCCCAAGGCCGCCTCATAGCCTCA TGGACACCTGTGTCGCCACCTTCCATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270484 |
Insert Size | 1134 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270484.1 |
RefSeq Size | 2233 bp |
RefSeq ORF | 1134 bp |
Locus ID | 6862 |
UniProt ID | O15178 |
Cytogenetics | 6q27 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
MW | 41.1 kDa |
Gene Summary | The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. Variation in this gene was associated with susceptibility to neural tube defects and chordoma. A mutation in this gene was found in a family with sacral agenesis with vertebral anomalies. [provided by RefSeq, Sep 2018] Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.