PFD6 (PFDN6) (NM_001265596) Human Untagged Clone

CAT#: SC330738

PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 4


  "NM_001265596" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PFDN6 (PFD6) mouse monoclonal antibody, clone OTI4E10 (formerly 4E10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PFD6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFD6
Synonyms H2-KE2; HKE2; KE-2; PFD6
Vector pCMV6-Entry
Sequence Data
>SC330738 representing NM_001265596.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTA
AGTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAA
CTGGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTG
GGGGAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCC
CAGCTTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTC
CAGCGGGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001265596
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001265596.1
RefSeq Size 594 bp
RefSeq ORF 390 bp
Locus ID 10471
UniProt ID O15212
Cytogenetics 6p21.32
Protein Families Stem cell - Pluripotency
MW 14.6 kDa
Gene Summary PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]).[supplied by OMIM, Jul 2010]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.