HARS1 (NM_001258042) Human Untagged Clone

CAT#: SC330635

HARS (untagged) - Homo sapiens histidyl-tRNA synthetase (HARS), transcript variant 4


  "NM_001258042" in other vectors (2)

Reconstitution Protocol

USD 719.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-HARS antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HARS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HARS1
Synonyms CMT2W; HARS; HRS; USH3B
Vector pCMV6-Entry
Sequence Data
>SC330635 representing NM_001258042.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGAGCGTGCGGCGCTGGAGGAGCTGGTGAAACTTCAGGGAGAGCGCGTGCGAGGCCTCAAGCAG
CAGAAGGCCAGCGCCGAGCTGATCGAGGAGGAGGTGGCGAAACTCCTGAAACTGAAGGCACAGCTGGGT
CCTGATGAAAGCAAACAGAAATTTGTGCTCAAAACCCCCAAGGAAACACTGATGGGAAAGTATGGGGAA
GACTCCAAGCTTATCTATGACCTGAAGGACCAGGGCGGGGAGCTCCTGTCCCTTCGCTATGACCTCACT
GTTCCTTTTGCTCGGTATTTGGCAATGAATAAACTGACCAACATTAAACGCTACCACATAGCAAAGGAT
TTTGACATTGCTGGGAACTTTGATCCCATGATCCCTGATGCAGAGTGCCTGAAGATCATGTGCGAGATC
CTGAGTTCACTTCAGATAGGCGACTTCCTGGTCAAGGTAAACGATCGACGCATTCTAGATGGGATGTTT
GCTATCTGTGGTGTTTCTGACAGCAAGTTCCGTACCATCTGCTCCTCAGTAGACAAGCTGGACAAGGTG
TCCTGGGAAGAGGTGAAGAATGAGATGGTGGGAGAGAAGGGCCTTGCACCTGAGGTGGCTGACCGCATT
GGGGACTATGTCCAGCAACATGGTGGGGTATCCCTGGTGGAACAGCTGCTCCAGGATCCTAAACTATCC
CAAAACAAGCAGGCCTTGGAGGGCCTGGGAGACCTGAAGTTGCTCTTTGAGTACCTGACCCTATTTGGC
ATTGATGACAAAATCTCCTTTGACCTGAGCCTTGCTCGAGGGCTGGATTACTACACTGGGGTGATCTAT
GAGGCAGTGCTGCTACAGACCCCAGCCCAGGCAGGGGAAGAGCCCCTGGGTGTGGGCAGTGTGGCTGCT
GGAGGACGCTATGATGGGCTAGTGGGCATGTTCGACCCCAAAGGGCGCAAGGTGCCATGTGTGGGGCTC
AGCATTGGGGTGGAGCGGATTTTCTCCATCGTGGAACAGAGACTAGAGGCTTTGGAGGAGAAGATACGG
ACCACGGAGACACAGGTGCTTGTGGCATCTGCACAGAAGAAGCTGCTAGAGGAAAGACTAAAGCTTGTC
TCAGAACTGTGGGATGCTGGGATCAAGGCTGAGCTGCTGTACAAGAAGAACCCAAAGCTACTGAACCAG
TTACAGTACTGTGAGGAGGCAGGCATCCCACTGGTGGCTATCATCGGCGAGCAGGAACTCAAGGATGGG
GTCATCAAGCTCCGTTCAGTGACGAGCAGGGAAGAGGTGGATGTCCGAAGAGAAGACCTTGTGGAGGAA
ATCAAAAGGAGAACAGGCCAGCCCCTCTGCATCTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258042
Insert Size 1350 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258042.1
RefSeq Size 2142 bp
RefSeq ORF 1350 bp
Locus ID 3035
UniProt ID P12081
Cytogenetics 5q31.3
Protein Pathways Aminoacyl-tRNA biosynthesis
MW 50.2 kDa
Gene Summary Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (4) lacks an alternate in-frame exon and uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.