PBR (TSPO) (NM_001256530) Human Untagged Clone

CAT#: SC330446

TSPO (untagged) - Homo sapiens translocator protein (18kDa) (TSPO), transcript variant 3


  "NM_001256530" in other vectors (2)

Reconstitution Protocol

USD 330.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PBR/TSPO Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PBR
Synonyms BPBS; BZRP; DBI; IBP; MBR; mDRC; PBR; PBS; pk18; PKBS; PTBR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC111597 sequence for NM_000714 edited (data generated by NextGen Sequencing)
ATGGCCCCGCCCTGGGTGCCCGCCATGGGCTTCACGCTGGCGCCCAGCCTGGGGTGCTTC
GTGGGCTCCCGCTTTGTCCACGGCGAGGGTCTCCGCTGGTACGCCGGCCTGCAGAAGCCC
TCGTGGCACCCGCCCCACTGGGTGCTGGGCCCTGTCTGGGGCACGCTCTACTCAGCCATG
GGGTACGGCTCCTACCTGGTCTGGAAAGAGCTGGGAGGCTTCACAGAGAAGGCTGTGGTT
CCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTT
GGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCA
GCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTAC
CTGGCCTGGCTGGCCTTCGCGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGC
TGGCGTGGGGGACGGCGGCTGCCAGAGTGA

Clone variation with respect to NM_000714.4
439 a=>g
Restriction Sites SgfI-MluI     
ACCN NM_001256530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256530.1, NP_001243459.1
RefSeq Size 1116 bp
RefSeq ORF 510 bp
Locus ID 706
UniProt ID P30536
Cytogenetics 22q13.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant PBR. Variants PBR, 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.