SNX12 (NM_001256188) Human Untagged Clone

CAT#: SC330381

SNX12 (untagged) - Homo sapiens sorting nexin 12 (SNX12), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX12
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330381 representing NM_001256188.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTCGGACACGGCAGTAGCTGATACCCGGCGCCTTAACTCGAAGCCGCAGGACCTGACCGACGCTTAC
  GGGCCGCCAAGTAACTTCCTGGAGATCGACATCTTTAATCCTCAGACGGTGGGCGTGGGACGCGCGCGC
  TTCACCACCTATGAGACAAACCTACCTATCTTCAAGCTAAAGGAGTCCTGCGTACGGCGGCGCTACAGT
  GACTTTGAGTGGCTGAAAAATGAGCTGGAGAGAGATAGCAAGATTGTAGTACCACCACTGCCTGGGAAA
  GCCTTGAAGCGGCAGCTCCCTTTCCGAGGAGATGAAGGGATCTTTGAGGAGTCTTTCATCGAAGAAAGG
  AGGCAGGGCCTCGAGCAGTTTATTAACAAAATTGCTGGGCACCCACTGGCTCAGAATGAACGCTGCCTA
  CACATGTTCCTGCAAGAGGAGGCAATTGACAGGAACTACGTCCCGGGGAAGGTGCGCCAGTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256188
• Insert Size: 477 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.

Reference Data

• RefSeq: NM_001256188.1
• RefSeq Size: 2404 bp
• RefSeq ORF: 477 bp
• Locus ID: 29934
• UniProt ID: Q9UMY4
• Cytogenetics: Xq13.1
• MW: 18.3 kDa
• Gene Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. A similar protein in mouse may be involved in regulating the neurite outgrowth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 4), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.