TRPM1 (NM_001252030) Human Untagged Clone
CAT#: SC330264
TRPM1 (untagged) - Homo sapiens transient receptor potential cation channel, subfamily M, member 1 (TRPM1), transcript variant 4
"NM_001252030" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRPM1 |
Synonyms | CSNB1C; LTRPC1; MLSN1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330264 representing NM_001252030.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAAGACTCTAACAGGTGTTGCTGTGGCCAGTTCACCAACCAGCATATCCCCCCTCTGCCAAGTGCA ACACCCAGCAAAAATGAAGAGGAAAGCAAACAGGTGGAGACTCAGCCTGAGAAATGGTCTGTTGCCAAG CACACCCAGAGCTACCCAACAGATTCCTATGGAGTTCTTGAATTCCAGGGTGGCGGATATTCCAATAAA GCCATGGTGAGAAAGGCATTCAGACATGGTGCCACTAGGATCACAGCTTTCATTGGCGGCCAGTCTCCC AGCCCCAAACTGCAGATACCTGGTCTTCTTCATGGCTGTGGCTCAATCTTCCTAGATATTTCATTGAAA AACCAAGAGATATATCTGTGCACATGGCTTTTAGCCATGAGGCTTGGAAACTGGACACCACTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252030 |
Insert Size | 411 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252030.1 |
RefSeq Size | 1002 bp |
RefSeq ORF | 411 bp |
Locus ID | 4308 |
UniProt ID | Q7Z4N2 |
Cytogenetics | 15q13.3 |
Protein Families | Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane |
MW | 15.1 kDa |
Gene Summary | This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. The resulting isoform (4) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231778 | TRPM1 (Myc-DDK tagged) - Homo sapiens transient receptor potential cation channel, subfamily M, member 1 (TRPM1), transcript variant 4 |
USD 165.00 |
|
RG231778 | TRPM1 (tGFP-tagged) - Homo sapiens transient receptor potential cation channel, subfamily M, member 1 (TRPM1), transcript variant 4 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review