TOR2A (NM_001252023) Human Untagged Clone
CAT#: SC330263
TOR2A (untagged) - Homo sapiens torsin family 2, member A (TOR2A), transcript variant 5
"NM_001252023" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "TOR2A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TOR2A |
Synonyms | TORP1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330263 representing NM_001252023.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCCTCCTGGGTGGTATAC GGGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGATGGCTTCTCAAACTCGGGCATCATGGAAGA GCGCCTCCTAGACGCAGTGGTGCCCTTCCTCCCGCTCCAGCGGCACCACGTCCGGCACTGCGTGCTCAA CGAGCTGGCCCAGCTGGGCCTGGAGCCAAGGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252023 |
Insert Size | 243 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252023.1 |
RefSeq Size | 1194 bp |
RefSeq ORF | 243 bp |
Locus ID | 27433 |
UniProt ID | Q5JU69 |
Cytogenetics | 9q34.11 |
Protein Families | Secreted Protein, Transmembrane |
MW | 8.7 kDa |
Gene Summary | This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (5) lacks two exons and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (e) is significantly shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.