TOR2A (NM_001252021) Human Untagged Clone

CAT#: SC330262

TOR2A (untagged) - Homo sapiens torsin family 2, member A (TOR2A), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TOR2A
• Synonyms: TORP1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330262 representing NM_001252021.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCCTCCTGGGTGGTATAC
  GGGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGCAACACGGGTGGCGAGCAGATCAACCAGGTG
  GCATTGGAGGCGTGGCGCAGCCGGCGGGACCGCGAGGAGATCCTCCTGCAGGAGCTGGAGCCGGTCATC
  TCCCGCGCGGTGCTGGACAACCCGCACCATGGCTTCTCAAACTCGGGCATCATGGAAGAGCGCCTCCTA
  GACGCAGTGGTGCCCTTCCTCCCGCTCCAGCGGCACCACGTCCGGCACTGCGTGCTCAACGAGCTGGCC
  CAGCTGGGCCTGGAGCCAAGGGATGAGGTTGTCCAGGCTGTGCTGGACAGCACCACCTTCTTCCCTGAA
  GACGAGCAGCTCTTCTCCTCCAACGGCTGCAAGACCGTGGCCTCCCGAATCGCCTTCTTCCTCTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252021
• Insert Size: 480 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252021.1
• RefSeq Size: 1319 bp
• RefSeq ORF: 480 bp
• Locus ID: 27433
• UniProt ID: Q5JU69
• Cytogenetics: 9q34.11
• Protein Families: Secreted Protein, Transmembrane
• MW: 18.1 kDa
• Gene Summary: This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (7) uses an alternate splice site, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 6 and 7 encode the same isoform (f), which has a shorter N-terminus compared to isoform a.