ATF7 (NM_001206682) Human Untagged Clone
CAT#: SC329828
ATF7 (untagged) - Homo sapiens activating transcription factor 7 (ATF7), transcript variant 4
"NM_001206682" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "ATF7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATF7 |
Synonyms | ATFA |
Vector | pCMV6-Entry |
Sequence Data |
>SC329828 representing NM_001206682.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGAGACGACAGACCGTTTGTGTGCAATGCCCCGGGCTGTGGACAGAGATTTACAAACGAGGACCAC CTGGCAGTTCATAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGACTCAGTCATC ATTGCAGATCAAACGCCTACTCCAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAA CTAGCTAGCTCCTTTGAACATGAATTCAAGAAAGCTGCAGATGAGGATGAGAAAAAGGCAAGAAGCAGG ACTGTTGCCAAAAAACTGGTGGTATTCAGACCTAGGCTATTTTTATTGTGCTTTGGGATAATTTTCTTA ATTGGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206682 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001206682.1 |
RefSeq Size | 867 bp |
RefSeq ORF | 354 bp |
Locus ID | 11016 |
UniProt ID | P17544 |
Cytogenetics | 12q13.13 |
Protein Families | Transcription Factors |
MW | 13.3 kDa |
Gene Summary | Plays important functions in early cell signaling. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AG][AG]-3'), a sequence present in many viral and cellular promoters. Activator of the NF-ELAM1/delta-A site of the E-selectin promoter. Has no intrinsic transcriptional activity, but activates transcription on formation of JUN or FOS heterodimers. Also can bind TRE promoter sequences when heterodimerized with members of the JUN family.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 2, resulting in an isoform (4) with a distinct and shorter C-terminus, compared to isoform 2. Variants 4, 5, and 13 all encode the same isoform (4). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.