LIPT1 (NM_001204830) Human Untagged Clone

CAT#: SC329767

LIPT1 (untagged) - Homo sapiens lipoyltransferase 1 (LIPT1), transcript variant 6


  "NM_001204830" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-LIPT1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LIPT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LIPT1
Synonyms LIPT1D
Vector pCMV6-Entry
Sequence Data
>SC329767 representing NM_001204830.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGATCCCATTTTCAATGAAGAATTGCTTCCAGTTACTTTGTAACTGCCAGGTCCCAGCAGCTGGC
TTTAAAAAAACAGTAAAAAATGGGCTCATTTTACAGTCAATTTCCAATGATGTCTATCAAAATCTGGCT
GTGGAAGACTGGATCCATGACCATATGAATCTAGAAGGCAAACCAATTCTATTCTTTTGGCAGAATTCT
CCCTCTGTTGTAATTGGTAGGCATCAAAATCCTTGGCAGGAATGTAACCTGAATCTAATGAGAGAAGAA
GGTATAAAACTGGCTCGGAGAAGAAGTGGAGGAGGAACAGTCTACCATGATATGGGTAATATCAATTTG
ACTTTCTTTACAACCAAAAAAAAGTATGATAGAATGGAAAATCTGAAATTAATTGTGAGAGCTCTGAAT
GCTGTCCAACCCCAGCTGGATGTGCAGGCTACCAAAAGATTTGACCTTTTACTTGATGGACAGTTTAAA
ATCTCAGGAACAGCTTCTAAGATCGGCCGGACTACTGCCTATCACCATTGCACTTTATTATGTAGTACT
GATGGGACGTTCTTGTCTTCTTTGCTAAAGAGCCCTTACCAAGGGATCAGGAGCAATGCCACTGCTAGC
ATACCTTCCTTAGTGAAAAATCTTTTGGAAAAGGATCCCACTCTGACCTGTGAAGTACTAATGAATGCT
GTTGCTACAGAGTATGCTGCTTATCATCAAATTGATAATCACATTCACCTAATAAACCCAACGGATGAG
ACACTGTTTCCTGGAATAAATAGCAAAGCCAAAGAACTGCAAACTTGGGAGTGGATATATGGCAAAACT
CCAAAGTTTAGTATAAATACTTCCTTTCATGTGTTATATGAACAGTCACACTTGGAAATTAAAGTATTC
ATAGACATAAAGAATGGAAGAATTGAAATTTGTAATATTGAAGCACCTGATCATTGGTTGCCATTGGAA
ATACGTGACAAATTAAATTCAAGTCTTATTGGCAGTAAGTTTTGCCCAACTGAAACTACCATGCTAACA
AATATATTACTTAGAACATGTCCACAAGACCACAAACTAAACAGTAAATGGAATATTCTCTGTGAAAAA
ATTAAGGGAATAATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204830
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204830.1
RefSeq Size 1627 bp
RefSeq ORF 1122 bp
Locus ID 51601
UniProt ID Q9Y234
Cytogenetics 2q11.2
Protein Pathways Lipoic acid metabolism, Metabolic pathways
MW 42.5 kDa
Gene Summary The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read-through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (6) uses an alternate 5'-most non-coding exon, compared to variant 1. Variants 1 and 3-6 all encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.