SH3 containing Grb 2 like 1 protein (SH3GL1) (NM_001199943) Human Untagged Clone

CAT#: SC329597

SH3GL1 (untagged) - Homo sapiens SH3-domain GRB2-like 1 (SH3GL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SH3 containing Grb 2 like 1 protein
• Synonyms: CNSA1; EEN; SH3D2B; SH3P8
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329597 representing NM_001199943.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTCGGTGGCGGGGCTGAAGAAGCAGTTCTACAAGGCGAGCCAGCTGGTCAGTGAGAAGGTCGGAGGG
  GCCGAGGGGACCAAGCTGGATGATGACTTCAAAGAGATGGAGAAGAAGGTGGATGTCACCAGCAAGGCG
  GTGACAGAAGTGCTGGCCAGGACCATCGAGTACCTGCAGCCCAACCCAGGTGACGCATTGCTGGATGCC
  GGCGAGTCCATGAAGCGCCTGGCAGAGGTGAAGGACTCCCTGGACATCGAGGTCAAGCAGAACTTCATT
  GACCCCCTCCAGAACCTGTGCGAGAAAGACCTGAAGGAGATCCAGCACCACCTGAAGAAACTGGAGGGC
  CGCCGCCTGGACTTTGACTACAAGAAGAAGCGGCAGGGCAAGATCCCCGATGAGGAGCTACGCCAGGCG
  CTGGAGAAGTTCGAGGAGTCCAAGGAGGTGGCAGAAACCAGCATGCACAACCTCCTGGAGACTGACATC
  GAGCAGGTGAGTCAGCTCTCGGCCCTGGTGGATGCACAGCTGGACTACCACCGGCAGGCCGTGCAGATC
  CTGGACGAGCTGGCGGAGAAGCTCAAGCGCAGGATGCGGGAAGCTTCCTCACGCCCTAAGCGGGAGTAT
  AAGCCCAAGCCCCGGGAGCCCTTTGACCTTGGAGAGCCTGAGCAGTCCAACGGGGGCTTCCCCTGCACC
  ACAGCCCCCAAGATCGCAGCTTCATCGTCTTTCCGATCTTCCGACAAGCCCATCCGGACCCCTAGCCGG
  AGCATGCCGCCCCTGGACCAGCCGAGCTGCAAGGCGCTGTACGACTTCGAGCCCGAGAACGACGGGGAG
  CTGGGCTTCCATGAGGGCGACGTCATCACGCTGACCAACCAGATCGATGAGAACTGGTACGAGGGCATG
  CTGGACGGCCAGTCGGGCTTCTTCCCGCTCAGCTACGTGGAGGTGCTTGTGCCCCTGCCGCAGTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199943
• Insert Size: 963 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199943.1
• RefSeq Size: 2415 bp
• RefSeq ORF: 963 bp
• Locus ID: 6455
• UniProt ID: Q99961
• Cytogenetics: 19p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• MW: 36.3 kDa
• Gene Summary: This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (2) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.