UBAP1 (NM_001171203) Human Untagged Clone

CAT#: SC328824

UBAP1 (untagged)-Human ubiquitin associated protein 1 (UBAP1) transcript variant 2


  "NM_001171203" in other vectors (4)

Reconstitution Protocol

USD 515.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-UBAP1 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "UBAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBAP1
Synonyms NAG20; SPG80; UAP; UBAP; UBAP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328824 representing NM_001171203.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCTAAGAAGTTGGGTGCAGATTTTCATGGGACTTTCAGTTACCTTGATGATGTCCCATTTAAG
ACAGGAGACAAATTCAAAACACCAGCTAAAGTTGGTCTACCTATTGGCTTCTCCTTGCCTGATTGTTTG
CAGGTTGTCAGAGAAGTACAGTATGACTTCTCTTTGGAAAAGAAAACCATTGAGTGGGCTGAAGAGATT
AAGAAAATCGAAGAAGCCGAGCGGGAAGCAGAGTGCAAAATTGCGGAAGCAGAAGCTAAAGTGAATTCT
AAGAGTGGCCCAGAGGGCGATAGCAAAATGAGCTTCTCCAAGACTCACAGTACAGCCACAATGCCACCT
CCTATTAACCCCATCCTCGCCAGCTTGCAGCACAACAGCATCCTCACACCAACTCGGGTCAGCAGTAGT
GCCACGAAACAGAAAGTTCTCAGCCCACCTCACATAAAGGCGGATTTCAATCTTGCTGACTTTGAGTGT
GAAGAAGACCCATTTGATAATCTGGAGTTAAAAACTATTGATGAGAAGGAAGAGCTGAGAAATATTCTG
GTAGGAACCACTGGACCCATTATGGCTCAGTTATTGGACAATAACTTGCCCAGGGGAGGCTCTGGGTCT
GTGTTACAGGATGAGGAGGTCCTGGCATCCTTGGAACGGGCAACCCTAGATTTCAAGCCTCTTCATAAA
CCCAATGGCTTTATAACCTTACCACAGTTGGGCAACTGTGAAAAGATGTCACTGTCTTCCAAAGTGTCC
CTCCCCCCTATACCTGCAGTAAGCAATATCAAATCCCTGTCTTTCCCCAAACTTGACTCTGATGACAGC
AATCAGAAGACAGCCAAGCTGGCGAGCACTTTCCATAGCACATCCTGCCTCCGCAATGGCACGTTCCAG
AATTCCCTAAAGCCTTCCACCCAAAGCAGTGCCAGTGAGCTCAATGGGCATCACACTCTTGGGCTTTCA
GCTTTGAACTTGGACAGTGGCACAGAGATGCCAGCCCTGACATCCTCCCAGATGCCTTCCCTCTCTGTT
TTGTCTGTGTGCACAGAGGAATCATCACCTCCAAATACTGGTCCCACGGTCACCCCTCCTAATTTCTCA
GTGTCACAAGTGCCCAACATGCCCAGCTGTCCCCAGGCCTATTCTGAACTGCAGATGCTGTCCCCCAGC
GAGCGGCAGTGTGTGGAGACGGTGGTCAACATGGGCTACTCGTACGAGTGTGTCCTCAGAGCCATGAAG
AAGAAAGGAGAGAATATTGAGCAGATTCTCGACTATCTCTTTGCACATGGACAGCTTTGTGAGAAGGGC
TTCGACCCTCTTTTAGTGGAAGAGGCTCTGGAAATGCACCAGTGTTCAGAAGAAAAGATGATGGAGTTT
CTTCAGTTAATGAGCAAATTTAAGGAGATGGGCTTTGAGCTGAAAGACATTAAGGAAGTTTTGCTATTA
CACAACAATGACCAGGACAATGCTTTGGAAGACCTCATGGCTCGGGCAGGAGCCAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001171203
Insert Size 1509 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001171203.2
RefSeq Size 2898 bp
RefSeq ORF 1509 bp
Locus ID 51271
UniProt ID Q9NZ09
Cytogenetics 9p13.3
MW 55.1 kDa
Gene Summary This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) is the longest transcript; it has an additional exon in the 5' UTR, as compared to variant 1. Variants 1-3 encode the same isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.