FLAD1 (NM_001184892) Human Untagged Clone

CAT#: SC328483

FLAD1 (untagged)-Human FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) (FLAD1) transcript variant 4


  "NM_001184892" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit polyclonal Anti-FLAD1 Antibody
    • 100 ul

USD 539.00

Other products for "FLAD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FLAD1
Synonyms FAD1; FADS; LSMFLAD; PP591
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328483 representing NM_001184892.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCCATCATCTTCAACCCCTCCCCTTCATCCCTACAGTACTGATGGCCTCATCTTCCCCTTCAAC
CCCCAGGGACACACTCAGGACACCAACACCTTCTTTCTGTGCCGGACACTGCGCTCCCTAGGGGTCCAG
GTTTGCCGAGTCTCAGTTGTACCTGATGAGGTAGCCACCATTGCAGCTGAGGTCACTTCTTTCTCCAAC
CGCTTCACCCATGTCCTCACAGCAGGGGGCATCGGCCCCACTCATGATGATGTGACCTTTGAGGCAGTG
GCACAGGCCTTTGGAGATGAGCTGAAGCCACACCCCAAGTTGGAAGCAGCCACCAAAGCCCTAGGAGGG
GAAGGCTGGGAGAAGCTATCATTGGTGCCCTCCTCTGCCCGCCTGCATTATGGCACAGATCCTTGCACT
GGTCAACCTTTCAGATTCCCTCTGGTCTCCGTCCGAAACGTCTACCTCTTCCCAGGCATTCCAGAGCTG
CTGCGGCGGGTGCTGGAGGGGATGAAGGGACTATTCCAAAACCCAGCTGTTCAGTTCCACTCAAAGGAG
CTATATGTGGCTGCTGATGAAGCCTCCATCGCCCCCATTCTGGCTGAGGCCCAGGCCCACTTTGGACGT
AGGCTTGGCCTGGGTTCCTACCCTGACTGGGGCAGCAACTACTATCAGGTGAAGCTGACTCTAGACTCA
GAGGAAGAAGGACCCCTGGAGGAATGCTTGGCCTACCTGACTGCCCGTTTGCCCCAGGGATCGCTGGTC
CCCTACATGCCCAACGCTGTGGAGCAGGCCAGTGAGGCTGTATACAAACTCGCTGAATCAGGTAGGGAC
CTTATGGAGGAGGGGCATTATGCCCAAAGCCATTGGTGGCACCCCAGATCTCAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184892
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184892.1
RefSeq Size 1911 bp
RefSeq ORF 885 bp
Locus ID 80308
UniProt ID Q8NFF5
Cytogenetics 1q21.3
Protein Pathways Metabolic pathways, Riboflavin metabolism
MW 32.4 kDa
Gene Summary This gene encodes the enzyme that catalyzes adenylation of flavin mononucleotide (FMN) to form flavin adenine dinucleotide (FAD) coenzyme. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) has multiple differences and initiates translation at an alternate start codon, compared to variant 1. The encoded protein (isoform 4) has a distinct N- and C-termini and is shorter when it is compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.