Syntaxin 3 (STX3) (NM_001178040) Human Untagged Clone

CAT#: SC328449

STX3 (untagged)-Human syntaxin 3 (STX3) transcript variant 2


  "NM_001178040" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
STX3 mouse monoclonal antibody,clone OTI3A5
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Syntaxin 3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Syntaxin 3
Synonyms STX3A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328449 representing NM_001178040.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGACCGTCTGGAGCAGCTGAAGGCCAAGCAGCTGACACAGGATGATGATACTGATGCGGTTGAG
ATTGCTATCGACAACACGGCTTTTATGGACGAGTTCTTTTCTGAGATTGAGGAAACTCGGCTTAACATT
GACAAGATCTCAGAACATGTAGAGGAGGCTAAGAAACTCTACAGTATCATTCTCTCTGCACCGATTCCA
GAGCCAAAAACCAAGGATGACCTAGAGCAGCTCACGACTGAGATTAAGAAAAGGGCCAACAACGTCCGG
AACAAACTGAAGAGCATGGAGAAGCATATTGAAGAAGATGAGGTCAGGTCATCGGCAGACCTTCGGATT
CGGAAATCCCAGCACTCTGTCCTTTCTCGGAAGTTTGTGGAGGTGATGACCAAATACAATGAAGCTCAA
GTGGACTTCCGAGAACGCAGCAAAGGGCGAATCCAGCGGCAGCTCGAAATTACTGGCAAAAAGACAACC
GATGAGGAGCTGGAGGAGATGTTGGAGAGTGGCAACCCGGCCATCTTCACTTCTGGGATCATTGACTCA
CAGATTTCCAAGCAAGCCCTCAGTGAGATTGAGGGACGACACAAGGACATTGTGAGGCTGGAGAGCAGC
ATCAAGGAGCTTCACGACATGTTTATGGACATCGCCATGCTGGTGGAGAATCAGGGTGAGATGTTAGAT
AACATAGAGTTGAATGTCATGCACACAGTGGACCACGTGGAGAAGGCACGAGATGAAACGAAAAAAGCT
GTGAAATACCAGAGTCAGGCCCGGAAGAAACTGATTTCACTCCAGACTGGTGTGGCCACCCTTGTCTTC
AGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001178040
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001178040.1
RefSeq Size 6384 bp
RefSeq ORF 834 bp
Locus ID 6809
UniProt ID Q13277
Cytogenetics 11q12.1
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 32 kDa
Gene Summary The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.