SCO2 (NM_001169111) Human Untagged Clone
CAT#: SC328433
SCO2 (untagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2) nuclear gene encoding mitochondrial protein transcript variant 4
"NM_001169111" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCO2 |
Synonyms | CEMCOX1; ECGF1; Gliostatin; MC4DN2; MYP6; PD-ECGF; SCO1L; TdRPase; TP; TYMP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001169111, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGG GTCCTCCCTGGGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGG CAGGGCCCTGCAGAGACAGGTGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAACCCGG CTGCTGATCACAGGCCTGTTCGGGGCTGGACTCGGTGGGGCCTGGCTGGCCCTGAGGGCT GAGAAGGAGAGGCTGCAGCAGCAAAAGCGAACAGAAGCCCTGCGCCAGGCAGCTGTGGGC CAGGGCGACTTCCACCTGCTGGATCACAGAGGCCGGGCTCGCTGCAAGGCTGACTTCCGG GGCCAGTGGGTGCTGATGTACTTTGGCTTCACTCACTGCCCTGACATCTGCCCAGACGAG CTGGAGAAGCTGGTGCAGGTGGTGCGGCAGCTGGAAGCAGAGCCTGGTTTGCCTCCAGTG CAGCCTGTCTTCATCACTGTGGACCCCGAGCGGGACGACGTTGAAGCCATGGCCCGCTAC GTCCAGGACTTCCACCCAAGACTGTTGGGTCTGACCGGCTCCACCAAACAGGTTGCCCAG GCTAGTCACAGTTACCGCGTGTACTACAATGCAGGCCCCAAGGATGAGGACCAGGACTAC ATCGTGGACCACTCCATTGCCATCTACCTGCTCAACCCTGACGGCCTCTTCACGGATTAC TACGGCCGGAGCAGATCGGCTGAGCAGATCTCAGACAGTGTGCGGCGGCACATGGCGGCT TTCCGCAGTGTCCTGTCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001169111 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001169111.1, NP_001162582.1 |
RefSeq Size | 1020 bp |
RefSeq ORF | 801 bp |
Locus ID | 9997 |
UniProt ID | O43819 |
Cytogenetics | 22q13.33 |
Protein Families | Druggable Genome |
Gene Summary | Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229795 | SCO2 (Myc-DDK-tagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 4 |
USD 300.00 |
|
RC229795L3 | Lenti-ORF clone of SCO2 (Myc-DDK-tagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 4 |
USD 600.00 |
|
RC229795L4 | Lenti-ORF clone of SCO2 (mGFP-tagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 4 |
USD 600.00 |
|
RG229795 | SCO2 (tGFP-tagged) - Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 4 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review