SFTPC (NM_001172357) Human Untagged Clone

CAT#: SC328299

SFTPC (untagged)-Human surfactant protein C (SFTPC) transcript variant 3


  "NM_001172357" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


SFTPC rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "SFTPC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SFTPC
Synonyms BRICD6; PSP-C; SFTP2; SMDP2; SP-C; SP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328299 representing NM_001172357.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGCCCGCCGGACTACTCCGCAGCTCCCCGGGGCCGA
TTTGGCATTCCCTGCTGCCCAGTGCACCTGAAACGCCTTCTTATCGTGGTGGTGGTGGTGGTCCTCATC
GTCGTGGTGATTGTGGGAGCCCTGCTCATGGGTCTCCACATGAGCCAGAAACACACGGAGATGGTTCTG
GAGATGAGCATTGGGGCGCCGGAAGCCCAGCAACGCCTGGCCCTGAGTGAGCACCTGGTTACCACTGCC
ACCTTCTCCATCGGCTCCACTGGCCTCGTGGTGTATGACTACCAGCAGCTGCTGATCGCCTACAAGCCA
GCCCCTGGCACCTGCTGCTACATCATGAAGATAGCTCCAGAGAGCATCCCCAGTCTTGAGGCTCTCACT
AGAAAAGTCCACAACTTCCAGGCCAAGCCCGCAGTGCCTACGTCTAAGCTGGGCCAGGCAGAGGGGCGA
GATGCAGGCTCAGCACCCTCCGGAGGGGACCCGGCCTTCCTGGGCATGGCCGTGAGCACCCTGTGTGGC
GAGGTGCCGCTCTACTACATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001172357
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172357.1
RefSeq Size 1187 bp
RefSeq ORF 576 bp
Locus ID 6440
UniProt ID P11686
Cytogenetics 8p21.3
Protein Families Secreted Protein, Transmembrane
MW 20.3 kDa
Gene Summary This gene encodes the pulmonary-associated surfactant protein C (SPC), an extremely hydrophobic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 2, also called pulmonary alveolar proteinosis due to surfactant protein C deficiency, and are associated with interstitial lung disease in older infants, children, and adults. Alternatively spliced transcript variants encoding different protein isoforms have been identified.[provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) lacks an in-frame segment in the 3' coding region and has an additional segment in the 3' UTR, as compared to variant 1. The transcript is longer than variant 1, but encodes a shorter isoform (2), as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.