5HT3A receptor (HTR3A) (NM_213621) Human Untagged Clone

CAT#: SC327899

HTR3A (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 3A (HTR3A) transcript variant 1


  "NM_213621" in other vectors (5)

Reconstitution Protocol

USD 529.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-HTR3A Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "5HT3A receptor"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol 5HT3A receptor
Synonyms 5-HT-3; 5-HT3A; 5-HT3R; 5HT3R; HTR3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327899 representing NM_213621.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTGGAAAGCTCGCTATGCTGCTGTGGGTCCAGCAGGCGCTGCTCGCCTTGCTCCTCCCCACACTC
CTGGCACAGGGAGAAGCCAGGAGGAGCCGAAACACCACCAGGCCCGCTCTGCTGAGGCTGTCGGATTAC
CTTTTGACCAACTACAGGAAGGGTGTGCGCCCCGTGAGGGACTGGAGGAAGCCAACCACCGTATCCATT
GACGTCATTGTCTATGCCATCCTCAACGTGGATGAGAAGAATCAGGTGCTGACCACCTACATCTGGTAC
CGGCAGTACTGGACTGATGAGTTTCTCCAGTGGAACCCTGAGGACTTTGACAACATCACCAAGTTGTCC
ATCCCCACGGACAGCATCTGGGTCCCGGACATTCTCATCAATGAGTTCGTGGATGTGGGGAAGTCTCCA
AATATCCCGTACGTGTATATTCGGCATCAAGGCGAAGTTCAGAACTACAAGCCCCTTCAGGTGGTGACT
GCCTGTAGCCTCGACATCTACAACTTCCCCTTCGATGTCCAGAACTGCTCGCTGACCTTCACCAGTTGG
CTGCACACCATCCAGGACATCAACATCTCTTTGTGGCGCTTGCCAGAAAAGGTGAAATCCGACAGGAGT
GTCTTCATGAACCAGGGAGAGTGGGAGTTGCTGGGGGTGCTGCCCTACTTTCGGGAGTTCAGCATGGAA
AGCAGTAACTACTATGCAGAAATGAAGTTCTATGTGGTCATCCGCCGGCGGCCCCTCTTCTATGTGGTC
AGCCTGCTACTGCCCAGCATCTTCCTCATGGTCATGGACATCGTGGGCTTCTACCTGCCCCCCAACAGT
GGCGAGAGGGTCTCTTTCAAGATTACACTCCTCCTGGGCTACTCGGTCTTCCTGATCATCGTTTCTGAC
ACGCTGCCGGCCACTGCCATCGGCACTCCTCTCATTGGTAAGGCCCCTCCTGGCAGCAGAGCTCAGTCT
GGTGAGAAACCCGCCCCCTCCCACCTCCTGCATGTGTCTCTTGCCTCTGCCCTGGGCTGCACAGGTGTC
TACTTTGTGGTGTGCATGGCTCTGCTGGTGATAAGTTTGGCCGAGACCATCTTCATTGTGCGGCTGGTG
CACAAGCAAGACCTGCAGCAGCCCGTGCCTGCTTGGCTGCGTCACCTGGTTCTGGAGAGAATCGCCTGG
CTACTTTGCCTGAGGGAGCAGTCAACTTCCCAGAGGCCCCCAGCCACCTCCCAAGCCACCAAGACTGAT
GACTGCTCAGCCATGGGAAACCACTGCAGCCACATGGGAGGACCCCAGGACTTCGAGAAGAGCCCGAGG
GACAGATGTAGCCCTCCCCCACCACCTCGGGAGGCCTCGCTGGCGGTGTGTGGGCTGCTGCAGGAGCTG
TCCTCCATCCGGCAATTCCTGGAAAAGCGGGATGAGATCCGAGAGGTGGCCCGAGACTGGCTGCGCGTG
GGCTCCGTGCTGGACAAGCTGCTATTCCACATTTACCTGCTAGCGGTGCTGGCCTACAGCATCACCCTG
GTTATGCTCTGGTCCATCTGGCAGTACGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_213621
Insert Size 1551 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_213621.3
RefSeq Size 2343 bp
RefSeq ORF 1551 bp
Locus ID 3359
UniProt ID P46098
Cytogenetics 11q23.2
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
MW 59 kDa
Gene Summary The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as h5-HT3RL, represents the longest transcript, and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.