DNAJB12 (NM_017626) Human Untagged Clone

CAT#: SC327833

DNAJB12 (untagged)-Human DnaJ (Hsp40) homolog subfamily B member 12 (DNAJB12) transcript variant 2


  "NM_017626" in other vectors (11)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-DNAJB12 Antibody
    • 100 ul

USD 539.00

Other products for "DNAJB12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNAJB12
Synonyms DJ10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327833 representing NM_017626.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCATCACTCCGCGCCCGGCTGCCCGCGACGCGCCGGCGGGTGGCGCAGCCCTTCGCTCGCCCGGCC
TCCCCCTCCCTGGTTCCGCGTTCTGGTTCCGCCATGGAATCCAACAAGGATGAAGCTGAGCGCTGTATC
AGCATCGCCCTCAAGGCCATCCAGAGCAACCAGCCCGACCGGGCGCTCCGCTTCCTGGAGAAGGCACAG
CGGCTGTATCCGACGCCGCGAGTTCGCGCCCTGATTGAGTCCCTCAACCAGAAACCACAGACTGCCGGT
GACCAACCCCCACCCACAGACACAACCCATGCCACCCACAGGAAAGCAGGTGGGACCGATGCCCCCTCG
GCCAACGGTGAAGCTGGAGGAGAGAGCACCAAAGGCTACACTGCAGAACAGGTTGCAGCTGTGAAAAGG
GTCAAGCAATGTAAAGATTACTATGAGATCCTGGGGGTGAGCAGAGGGGCCTCGGATGAGGACCTGAAG
AAGGCCTACCGCAGACTGGCCCTCAAATTCCACCCAGACAAGAACCACGCACCTGGTGCCACTGAAGCC
TTCAAAGCCATTGGCACAGCATATGCGGTACTCAGCAACCCGGAGAAGAGGAAGCAGTATGACCAGTTC
GGCGATGACAAGAGCCAGGCGGCCCGGCACGGCCATGGGCATGGGGATTTCCACCGTGGCTTTGAGGCC
GACATCTCCCCTGAAGACCTCTTCAACATGTTCTTTGGCGGCGGCTTCCCTTCTAGTAACGTCCACGTC
TACAGCAACGGCCGCATGCGCTATACCTACCAGCAAAGGCAGGACCGCAGGGACAACCAGGGTGATGGC
GGGCTAGGGGTGTTTGTGCAGCTGATGCCTATCCTCATCCTGATTCTCGTGTCAGCTCTCAGCCAGCTC
ATGGTCTCCAGTCCACCCTACAGTCTGAGTCCAAGACCGTCCGTGGGCCACATCCACAGGCGAGTCACT
GACCACCTGGGTGTCGTCTACTATGTGGGAGACACTTTCTCCGAAGAGTACACAGGCTCCAGCCTCAAA
ACAGTCGAGCGGAATGTGGAAGATGATTATATCGCCAACCTCCGGAACAACTGCTGGAAGGAGAAGCAG
CAGAAGGAAGGCTTGCTGTACCGGGCACGCTACTTTGGCGACACAGATATGTACCACAGAGCACAGAAG
ATGGGCACCCCCAGCTGCAGCCGACTGTCAGAGGTGCAGGCCTCCCTGCATGGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_017626
Insert Size 1230 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_017626.4
RefSeq Size 3215 bp
RefSeq ORF 1230 bp
Locus ID 54788
UniProt ID Q9NXW2
Cytogenetics 10q22.1
Domains DnaJ
Protein Families Transmembrane
MW 45.5 kDa
Gene Summary DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1, 2 and 4 encode the same protein. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.