RAD51 (NM_133487) Human Untagged Clone

CAT#: SC327800

RAD51 (untagged)-Human RAD51 homolog (RecA homolog E. coli) (S. cerevisiae) (RAD51) transcript variant 2


  "NM_133487" in other vectors (7)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RAD51"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAD51
Synonyms BRCC5; FANCR; HRAD51; HsRad51; HsT16930; MRMV2; RAD51A; RECA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_133487, the custom clone sequence may differ by one or more nucleotides
ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTT
GGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAA
TTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTA
ATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGACGGAGTCTCGCTCT
GTTGCCAGGCTGGAGTGCAATAGCGTGATCTTGGTCTACTGCACCCTCCGCCTCTCAGGT
TCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGTTGGGACTACAGGTGGAATTGAGACT
GGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACG
CTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTAC
ATTGACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGT
CTCTCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCAC
CAGACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTT
ATTGTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCA
GCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTT
GGTGTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTT
GCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGA
TTGTATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGT
CTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGAC
Restriction Sites Please inquire     
ACCN NM_133487
Insert Size 2302 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133487.3, NP_597994.3
RefSeq Size 2302 bp
RefSeq ORF 1023 bp
Locus ID 5888
UniProt ID Q06609
Cytogenetics 15q15.1
Domains HHH
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Protein Pathways Homologous recombination, Pancreatic cancer, Pathways in cancer
Gene Summary The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Transcript Variant: This variant (2) represents the longest transcript and encodes the longest isoform (2). Both variants 2 and 4 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.