MPPED2 (NM_001145399) Human Untagged Clone

CAT#: SC326546

MPPED2 (untagged)-Human metallophosphoesterase domain containing 2 (MPPED2), transcript variant 2, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MPPED2
• Synonyms: 239FB; C11orf8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326546 representing NM_001145399.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCACATGGGATTCCTTCTCAAGGCAAAGTTACCATAACGGTGGATGAGTACAGCTCAAACCCCACC
  CAGGCATTCACGCACTACAACATCAACCAGAGCAGATTCCAGCCTCCACATGTACATATGGTCGACCCC
  ATCCCATATGACACTCCAAAACCAGCGGGCCACACGCGGTTTGTCTGCATCTCAGACACACACTCCAGA
  ACAGATGGTATCCAGATGCCTTATGGGGACATCCTTCTCCACACAGGCGATTTCACCGAGCTGGGACTG
  CCCTCAGAGGTTAAGAAGTTTAATGACTGGTTAGGAAACCTGCCATATGAATATAAAATAGTGATTGCT
  GGGAATCATGAACTGACATTTGATAAGGAATTCATGGCAGACCTTGTTAAACAGGACTACTACCGTTTC
  CCCTCTGTGTCCAAATTGAAACCAGAGGACTTTGACAATGTTCAGTCCCTCCTGACAAACAGTATTTAC
  TTACAAGATTCGGAGGTAACAGTGAAGGGATTCAGGATATACGGTGCACCTTGGACCCCGTGGTTTAAT
  GGATGGGGCTTTAACCTACCCAGAGGTCAGTCTCTGCTGGACAAGTGGAACCTCATCCCTGAGGGCATT
  GACATACTCATGACACATGGACCTCCTCTAGGTTTTCGAGACTGGGTTCCAAAGGAGCTTCAAAGAGTG
  GGCTGTGTGGAGCTGTTAAACACGGTTCAGAGGCGAGTCCGGCCCAAGCTCCATGTGTTTGGTGGAATC
  CATGAAGTAAACCCTGTGAGCATCTCCAAGGCACTGAGGACAAAAATATGTTCTCTGCCTTCAAAAACT
  TCCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145399
• Insert Size: 834 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001145399.1
• RefSeq Size: 5693 bp
• RefSeq ORF: 834 bp
• Locus ID: 744
• UniProt ID: Q15777
• Cytogenetics: 11p14.1
• MW: 31.5 kDa
• Gene Summary: This gene likely encodes a metallophosphoesterase. The encoded protein may play a role a brain development. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
  Transcript Variant: This variant (2) differs in the 5' and the 3' UTR and contains an alternate exon in the 3' coding region compared to variant 1, that results in a frameshift. It encodes isoform 2, which has a shorter and distinct C-terminus compared to isoform 1.