DC SIGN (CD209) (NM_001144896) Human Untagged Clone

CAT#: SC325851

CD209 (untagged)-Human CD209 molecule (CD209), transcript variant 3


  "NM_001144896" in other vectors (4)

Reconstitution Protocol

USD 732.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD209"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD209
Synonyms CDSIGN; CLEC4L; DC-SIGN; DC-SIGN1; hDC-SIGN
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144896, the custom clone sequence may differ by one or more nucleotides
ATGAGTGACTCCAAGGAACCAAGACTGCAGCAGCTGGGCCTCCTGGAGGAGGAACAGCTG
AGAGGCCTTGGATTCCGACAGACTCGAGGATACAAGAGCTTAGCAGTGTCCAAGGTCCCC
AGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTT
AAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTG
ACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTAC
CAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAG
GAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCT
AAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCA
GAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGT
GAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCT
GCAGTGGGTGAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCAG
CTGAAGGCTGCAGTGGAACGCCTGTGCCACCCCTGTCCCTGGGAATGGACATTCTTCCAA
GGAAACTGTTACTTCATGTCTAACTCCCAGCGGAACTGGCACGACTCCATCACCGCCTGC
AAAGAAGTGGGGGCCCAGCTCGTCGTAATCAAAAGTGCTGAGGAGCAGAACTTCCTACAG
CTGCAGTCTTCCAGAAGTAACCGCTTCACCTGGATGGGACTTTCAGATCTAAATCAGGAA
GGCACGTGGCAATGGGTGGACGGCTCACCTCTGTTGCCCAGCTTCAAGCAGTATTGGAAC
AGAGGAGAGCCCAACAACGTTGGGGAGGAAGACTGCGCGGAATTTAGTGGCAATGGCTGG
AACGACGACAAATGTAATCTTGCCAAATTCTGGATCTGCAAAAAGTCCGCAGCCTCCTGC
TCCAGGGATGAAGAACAGTTTCTTTCTCCAGCCCCTGCCACCCCAAACCCCCCTCCTGCG
Restriction Sites Please inquire     
ACCN NM_001144896
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144896.1, NP_001138368.1
RefSeq Size 4256 bp
RefSeq ORF 1143 bp
Locus ID 30835
UniProt ID Q9NNX6
Cytogenetics 19p13.2
Protein Families Druggable Genome
Gene Summary This gene encodes a C-type lectin that functions in cell adhesion and pathogen recognition. This receptor recognizes a wide range of evolutionarily divergent pathogens with a large impact on public health, including leprosy and tuberculosis mycobacteria, the Ebola, hepatitis C, HIV-1 and Dengue viruses, and the SARS-CoV acute respiratory syndrome coronavirus. The protein is organized into four distinct domains: a C-terminal carbohydrate recognition domain, a flexible tandem-repeat neck domain, a transmembrane region and an N-terminal cytoplasmic domain involved in internalization. This gene is closely related in terms of both sequence and function to a neighboring gene, CLEC4M (Gene ID: 10332), also known as L-SIGN. The two genes differ in viral recognition and expression patterns, with this gene showing high expression on the surface of dendritic cells. Polymorphisms in the neck region are associated with protection from HIV-1 infection, while single nucleotide polymorphisms in the promoter of this gene are associated with differing resistance and susceptibility to and severity of infectious disease, including rs4804803, which is associated with SARS severity. [provided by RefSeq, May 2020]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter and lacks the transmembrane domain compared to isoform 1. Sequence Note: This record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.